We narrowed to 14,624 results for: RING
-
Plasmid#244086PurposeCytosolic expression of green glucose sensor (high affinity) with non-responsive HaloTagDepositorInsertiGlucoSnFR2.H348H.HaloTag
UseAAVTagsHaloTagAvailable SinceSept. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.GFAP.(cyto).iGlucoSnFR2.mIRFP670nano3
Plasmid#244087PurposeCytosolic expression of green glucose sensor with non-responsive mIRFPDepositorInsertiGlucoSnFR2.mIRFP670nano3
UseAAVTagsmIRFP670nano3Available SinceSept. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CAGFLEX.(cyto).iGlucoSnFR2.mIRFP670nano3
Plasmid#244080PurposeCytosolic expression of green glucose sensor with non-responsive mIRFPDepositorInsertiGlucoSnFR2.mIRFP670nano3
UseAAVTagsmIRFP670nano3Available SinceSept. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CAGFLEX.(ER).iGlucoSnFR2.HaloTag
Plasmid#244083PurposeER targeted expression of green glucose sensor with non-responsive HaloTagDepositorInsertiGlucoSnFR2.HaloTag
UseAAVTagsIgG kappa leader and mIRFP670nano3Available SinceSept. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.GFAP.(ER).iGlucoSnFR2.HaloTag
Plasmid#244090PurposeER targeted expression of green glucose sensor with non-responsive HaloTagDepositorInsertiGlucoSnFR2.HaloTag
UseAAVTagsIgG kappa leader and mIRFP670nano3Available SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.GFAP.(cyto).iGlucoSnFR2.HaloTag
Plasmid#244085PurposeCytosolic expression of green glucose sensor with non-responsive HaloTagDepositorInsertiGlucoSnFR2.HaloTag
UseAAVTagsHaloTagAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSmBit-CHIP-G132N
Plasmid#236065PurposeSmBit-CHIP expression with G132N substitutionDepositorAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSmBit-CHIP-K30A
Plasmid#236066PurposeSmBit-CHIP expression with K30A substitutionDepositorAvailable SinceSept. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pVBL0001
Plasmid#242429PurposeStable genomic integration of Opto-IRE1 (HsIRE1dLD-mCherry-CRY2clust) using the Flp-in system.DepositorInsertIRE1alpha (ERN1 Human)
TagsmCherry, CRY2clustExpressionMammalianMutationDeletion of the lumenal domainPromoterCMV, tet-inducibleAvailable SinceAug. 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA-d5-HT1AR
Plasmid#221820PurposePlasmid to express gRNA (gaccagtccactaccgcagc) for editing at the end of Drosophila 5-HT1AR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-d5-HT1BR
Plasmid#221821PurposePlasmid to express gRNA1 (gaaaatttgatttcaactga) for editing at the end of Drosophila 5-HT1BR coding frameDepositorInsertd5-HT1BR gRNA1 (5-HT1B Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT1BR
Plasmid#221822PurposePlasmid to express gRNA2 (aatttcgacgggccttcaag) for editing at the end of Drosophila 5-HT1BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-5-HT2AR-isoformD
Plasmid#221823PurposePlasmid to express gRNA1 (tccttctggcgcaaacacgg) for editing at the end of Drosophila 5-HT2AR isoform D coding frameDepositorInsertd5-HT2AR isoform D gRNA1 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterDrosophila U6 promoterAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT2AR-isoformD
Plasmid#221824PurposePlasmid to express gRNA2 (ctgaagacataattacgtgg) for editing at the end of Drosophila 5-HT2AR isoform D coding frameDepositorInsertd5-HT2AR isoform D gRNA2 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-5-HT2AR-isoformBFH
Plasmid#221825PurposePlasmid to express gRNA1 (cgctatcggtctgtgacaga) for editing at the end of Drosophila 5-HT2AR isoforms B, F and H coding frameDepositorInsertd5-HT2AR isoforms BFH gRNA1 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT2AR-isoformBFH
Plasmid#221826PurposePlasmid to express gRNA2 (ggaaaagccgctaattacag) for editing at the end of Drosophila 5-HT2AR isoforms B, F and H coding frameDepositorInsertd5-HT2AR isoforms BFH gRNA2 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterDrosophila U6 promoterAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA-d5-HT7R
Plasmid#221829PurposePlasmid to express gRNA (ggcgagggagagctttctct) for editing at the end of Drosophila 5-HT1AR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
mC4-GFP
Plasmid#221339PurposeExpresses murine homolog of complement 4 fused with GFP under CAG promoterDepositorAvailable SinceAug. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
PX459_NRF2-exon5-1
Plasmid#177781PurposesgRNA for CRISPR/Cas9-mediated deletion of human NRF2DepositorInsertNRF2 (NFE2L2 Human)
UseCRISPRAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
PX459_NRF2-exon5-2
Plasmid#177782PurposesgRNA for CRISPR/Cas9-mediated deletion of human NRF2DepositorInsertNRF2 (NFE2L2 Human)
UseCRISPRAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAGIG-Sema7A-ΔSEMA
Plasmid#190647PurposeExpresses Mouse Sema7A with SEMA domain deletedDepositorAvailable SinceJuly 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAGIG-Sema7A-ΔIG
Plasmid#190648PurposeExpresses Mouse Sema7A with IG Domain DeletedDepositorAvailable SinceJuly 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAGIG-Sema7A-ΔPSI
Plasmid#190649PurposeExpresses Mouse Sema7A with PSI domain deletedDepositorAvailable SinceJuly 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAGIG-Sema7A-KCE
Plasmid#190651PurposeExpresses Mouse Sema7A with RGD motif mutated to KCEDepositorAvailable SinceJuly 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAG-sp-myc-hSema4D
Plasmid#190654PurposeExpresses Human Sema4D with N terminal myc after signal peptideDepositorAvailable SinceJuly 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCS2+ Zf nhsl1b-mNeongreen
Plasmid#233883PurposemNeongreen tagged form of zebrafish nhsl1b. For in vitro transcription (SP6) or expression through CMV.DepositorInsertnhsl1b (nhsl1b Zebrafish)
UseIn vitro synthesis of mrnaTagsmNeongreenExpressionMammalianAvailable SinceJuly 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
EW428 CMV-TO-ZNF35(5-8)-ZNF35(5-8)-deImmLink-ZIK1KRAB
Plasmid#236141PurposePlasmid encoding the ZNF35/ZNF35 zinc finger array attached by a deimmunized linker to the ZIK1 KRAB domain, under control of CMV promoter with two TetR binding sitesDepositorInsertZNF35(5-8)-ZNF35(5-8)-deImmunLink-ZIK1KRAB
ExpressionMammalianPromoterCMV promoter with two TetR binding sitesAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
EW265 SFFV-mCherry-SGc(stem-1(3xPUF9R-tar))cSG-EGFP (FLP-IN)
Plasmid#236124PurposePlasmid encoding fluorescent reporter for PUF-9R binding which expresses mCherry constitutively and EGFP upon stop codon deamination due to ADAR-PUF9R bindingDepositorInsertmCherry-SGc(stem-1(3xPUF9R-tar))cSG-EGFP
ExpressionMammalianPromoterSFFVAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
EW152 CMV-TO-Gal4-NZF[Mutated Linkers] (FLP-IN)
Plasmid#236123PurposePlasmid encoding Gal4-NZF transcription factor with deimmunized linkers between the component domains of NZF, under control of CMV promoter with two TetR binding sitesDepositorInsertGal4-NZF (mutated linkers)
ExpressionMammalianPromoterCMV promoter with two TetR binding sitesAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
EW408 (ZNF35tar-compact)x8-H2B-GFP
Plasmid#236129PurposeFuorescent reporter encoding H2B-GFP fusion under control of E1b minimal promoter with eight ZNF35 binding sites upstreamDepositorInsertH2B (H2BC11 Human)
TagsEGFPExpressionMammalianPromoterE1b minimal promoter with eight ZNF35 binding sit…Available SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
EW369 CMV-TO-ZNF35(5-8)-ZNF250(1-4)-deImmunLink-NZF(FLP-IN)
Plasmid#236145PurposePlasmid encoding the ZNF35/ZNF250 zinc finger array attached by a deimmunized linker to the NZF transcriptional activation domain, under control of CMV promoter with two TetR binding sitesDepositorInsertZNF35(5-8)-ZNF250(1-4)-deImmunLink-NZF
ExpressionMammalianPromoterCMV promoter with two TetR binding sitesAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
EW490 CMV-TO-UTRN-14ZF-realdeImmLink-NZF (FLP-IN)
Plasmid#236149PurposePlasmid encoding the UTRN-14 zinc finger array attached by a deimmunized linker to the NZF transcriptional activation domain, under control of CMV promoter with two TetR binding sitesDepositorInsertUTRN-14ZF-deImmLink-NZF
ExpressionMammalianPromoterCMV promoter with two TetR binding sitesAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
EW409 ZNF250tarv3 x8-H2B-GFP
Plasmid#236133PurposeFuorescent reporter encoding H2B-GFP fusion under control of E1b minimal promoter with eight ZNF250 binding sites upstreamDepositorInsertH2B (H2BC11 Human)
TagsEGFPExpressionMammalianPromoterE1b minimal promoter with eight ZNF250 binding si…Available SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
SCN1Aprom(1-500)-H2B-GFP
Plasmid#236162PurposeFluorescent reporter encoding H2B-GFP fusion under control of E1b minimal promoter with the SCN1a promoter region encompassing 500 bp upstream of its transcriptional start siteDepositorInsertH2B (H2BC11 Human)
TagsEGFPExpressionMammalianPromoterE1b minimal promoter with the SCN1a promoter regi…Available SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
EW368 CMV-TO-UtroUpZF-deImmunLink-NZF(FLP-IN)
Plasmid#236154PurposePlasmid encoding the UtroUp zinc finger array attached by a deimmunized linker to the NZF transcriptional activation domain, under control of CMV promoter with two TetR binding sitesDepositorInsertUtroUpZF-deImmunLink-NZF
ExpressionMammalianPromoterCMV promoter with two TetR binding sitesAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
EW392 CMV-TO-NZF-(GGS)x8-FRB(T2098L) (FLP-IN)
Plasmid#236157PurposeExpresses NZF transcriptional activation domain attached by a GS linker to the mTOR FRB rapamycin binding domain with the T098L mutation, under control of CMV promoter with two TetR binding sitesDepositorInsertNZF-FRB
ExpressionMammalianMutationT2098L in FRBPromoterCMV promoter with two TetR binding sitesAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
EW416 CMV-TO-ZNF35(5-8)-ZNF250(1-4)-deImmLink-ZIK1KRAB
Plasmid#236140PurposePlasmid encoding the ZNF35/ZNF250 zinc finger array attached by a deimmunized linker to the ZIK1 KRAB domain, under control of CMV promoter with two TetR binding sitesDepositorInsertZNF35(5-8)-ZNF250(1-4)-deImmunLink-ZIK1KRAB
ExpressionMammalianPromoterCMV promoter with two TetR binding sitesAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
EW425 CMV-TO-ZNF35(5-8)-IKZF1(2-3)-realDeImmLink-ZIK1KRAB
Plasmid#236142PurposePlasmid encoding the ZNF35/IKZF1 zinc finger array attached by a deimmunized linker to the ZIK1 KRAB domain, under control of CMV promoter with two TetR binding sitesDepositorInsertZNF35(5-8)-IKZF1(2-3)-deImmunLink-ZIK1KRAB
ExpressionMammalianPromoterCMV promoter with two TetR binding sitesAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCM100_ PB5'IR-hU6-gRNA-CS1- CAG-tdTomato- PB3'IR
Plasmid#229995PurposePiggyBac sgRNA cloning plasmid with tdTomato reporter with a capture sequence (cs1)DepositorTypeEmpty backboneUseCRISPRTagsNotI site for NEBuilder HiFi DNA Assembly with ss…ExpressionMammalianPromoterCAGAvailable SinceFeb. 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPB758
Plasmid#210033PurposeContains inducible Cas7-P2A-Cas5-T2A-Cas8, rtTA-T2A-puroDepositorInsertsCas7-P2A-Cas5-T2A-Cas8
rtta-T2A-puro
UseCRISPRTagsSV40 NLSExpressionMammalianPromoterEF-1α and TRE3GAvailable SinceFeb. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHIV-EF1a-Il1a-ZsGreen
Plasmid#231987PurposeExpress IL-1alpha-ZsGreen fusion proteinDepositorInsertIL-1alpha-ZsGreen fusion construct
UseLentiviralAvailable SinceJan. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
LC3B-TdLanYFP
Plasmid#228565PurposeEncodes an acceptor-only, TdLanYFP-tagged version of the LC3B biosensor under the control of the CMV promoterDepositorAvailable SinceJan. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
Aquamarine-LC3B G120A
Plasmid#228563PurposeEncodes a donor-only, Aquamarine-tagged version of the inactive LC3B biosensor under the control of the CMV promoterDepositorAvailable SinceJan. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
Aquamarine-LC3B
Plasmid#228559PurposeEncodes a donor-only, Aquamarine-tagged version of the LC3B biosensor under the control of the CMV promoterDepositorAvailable SinceJan. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMV-TC1-2_DM
Plasmid#217081PurposeDonor plasmid of TC1-2_DM TransposonDepositorInsertTIRs of TC1-2_DM transposon
ExpressionMammalianAvailable SinceJan. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMV-PROTOP
Plasmid#217091PurposeDonor plasmid of PROTOP TransposonDepositorInsertTIRs of PROTOP transposon
ExpressionMammalianAvailable SinceJan. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMV-Tc1-8_Xt
Plasmid#217092PurposeDonor plasmid of Tc1-8_Xt TransposonDepositorInsertTIRs of Tc1-8_Xt transposon
ExpressionMammalianAvailable SinceDec. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMV-TC1_FR2
Plasmid#217085PurposeDonor plasmid of TC1_FR2 TransposonDepositorInsertTIRs of TC1_FR2 transposon
ExpressionMammalianAvailable SinceDec. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMV-MARISP1
Plasmid#217049PurposeDonor plasmid of MARISP1 TransposonDepositorInsertTIRs of MARISP1 transposon
ExpressionMammalianAvailable SinceDec. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPD1178-LPDV promoterless PuroR-P2A-miRFP720
Plasmid#201537PurposeLanding pad destination vector for mMoClo golden gate-based assembly of landing pad integration vectors; contains BxB1 attB site, promoterless puromycin resistance gene and miRFP720 geneDepositorInsertPromoterless PuroR-P2A-miRFP720
ExpressionMammalianPromoterNoneAvailable SinceDec. 19, 2024AvailabilityAcademic Institutions and Nonprofits only