We narrowed to 14,204 results for: RING;
-
Plasmid#244092PurposeCytosolic expression of green glucose sensor with non-responsive mRuby3DepositorInsertiGlucoSnFR2.mRuby3
UseAAVTagsmRuby3Available SinceSept. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSynap.(cyto).iGlucoSnFR2.HaloTag
Plasmid#244094PurposeCytosolic expression of green glucose sensor with non-responsive HaloTagDepositorInsertiGlucoSnFR2.HaloTag
UseAAVTagsHaloTagAvailable SinceSept. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSynap.(cyto).iGlucoSnFR2.H348H.HaloTag
Plasmid#244095PurposeCytosolic expression of green glucose sensor (high affinity) with non-responsive HaloTagDepositorInsertiGlucoSnFR2.H348H.HaloTag
UseAAVTagsHaloTagAvailable SinceSept. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSynapFLEX.(cyto).iGlucoSnFR2.mIRFP670nano3
Plasmid#244100PurposeCytosolic expression of green glucose sensor with non-responsive mIRFPDepositorInsertiGlucoSnFR2.mIRFP670nano3
UseAAVTagsmIRFP670nano3Available SinceSept. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.GFAP.(cyto).iGlucoSnFR2.H348H.HaloTag
Plasmid#244086PurposeCytosolic expression of green glucose sensor (high affinity) with non-responsive HaloTagDepositorInsertiGlucoSnFR2.H348H.HaloTag
UseAAVTagsHaloTagAvailable SinceSept. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.GFAP.(cyto).iGlucoSnFR2.mIRFP670nano3
Plasmid#244087PurposeCytosolic expression of green glucose sensor with non-responsive mIRFPDepositorInsertiGlucoSnFR2.mIRFP670nano3
UseAAVTagsmIRFP670nano3Available SinceSept. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CAGFLEX.(cyto).iGlucoSnFR2.mIRFP670nano3
Plasmid#244080PurposeCytosolic expression of green glucose sensor with non-responsive mIRFPDepositorInsertiGlucoSnFR2.mIRFP670nano3
UseAAVTagsmIRFP670nano3Available SinceSept. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CAGFLEX.(ER).iGlucoSnFR2.HaloTag
Plasmid#244083PurposeER targeted expression of green glucose sensor with non-responsive HaloTagDepositorInsertiGlucoSnFR2.HaloTag
UseAAVTagsIgG kappa leader and mIRFP670nano3Available SinceSept. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSynapFLEX.(mem).iGlucoSnFR2.mIRFP670nano3
Plasmid#244102PurposePlasma membrane targeted expression of green glucose sensor with non-responsive mIRFPDepositorInsertiGlucoSnFR2.mIRFP670nano3
UseAAVTagsIgG kappa leader and mIRFP670nano3Available SinceSept. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.GFAP.(mem).iGlucoSnFR2.mRuby3
Plasmid#244089PurposePlasma membrane targeted expression of green glucose sensor with non-responsive mRuby3DepositorInsertiGlucoSnFR2.mRuby3
UseAAVTagsIgG kappa leader and mRuby3Available SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.GFAP.(cyto).iGlucoSnFR2.mRuby3
Plasmid#244084PurposeCytosolic expression of green glucose sensor with non-responsive mRuby3DepositorInsertiGlucoSnFR2.mRuby3
UseAAVTagsmRuby3Available SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.GFAP.(ER).iGlucoSnFR2.HaloTag
Plasmid#244090PurposeER targeted expression of green glucose sensor with non-responsive HaloTagDepositorInsertiGlucoSnFR2.HaloTag
UseAAVTagsIgG kappa leader and mIRFP670nano3Available SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.GFAP.(cyto).iGlucoSnFR2.HaloTag
Plasmid#244085PurposeCytosolic expression of green glucose sensor with non-responsive HaloTagDepositorInsertiGlucoSnFR2.HaloTag
UseAAVTagsHaloTagAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
sgRNA-Dual_filler(hU6_H1)-EF1a-Thy1.1-P2A-Neo
Plasmid#239608PurposeBackbone for the cloning of a dual sgRNA expression plasmid (hU6 and H1 promoters) using BsmbI. Selectable with a G418 resistanceDepositorInsertfiller-trcr-H1-filler
UseCRISPR and LentiviralAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pVBL0001
Plasmid#242429PurposeStable genomic integration of Opto-IRE1 (HsIRE1dLD-mCherry-CRY2clust) using the Flp-in system.DepositorInsertIRE1alpha (ERN1 Human)
TagsmCherry, CRY2clustExpressionMammalianMutationDeletion of the lumenal domainPromoterCMV, tet-inducibleAvailable SinceAug. 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA-d5-HT1AR
Plasmid#221820PurposePlasmid to express gRNA (gaccagtccactaccgcagc) for editing at the end of Drosophila 5-HT1AR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-d5-HT1BR
Plasmid#221821PurposePlasmid to express gRNA1 (gaaaatttgatttcaactga) for editing at the end of Drosophila 5-HT1BR coding frameDepositorInsertd5-HT1BR gRNA1 (5-HT1B Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT1BR
Plasmid#221822PurposePlasmid to express gRNA2 (aatttcgacgggccttcaag) for editing at the end of Drosophila 5-HT1BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-5-HT2AR-isoformD
Plasmid#221823PurposePlasmid to express gRNA1 (tccttctggcgcaaacacgg) for editing at the end of Drosophila 5-HT2AR isoform D coding frameDepositorInsertd5-HT2AR isoform D gRNA1 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterDrosophila U6 promoterAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT2AR-isoformD
Plasmid#221824PurposePlasmid to express gRNA2 (ctgaagacataattacgtgg) for editing at the end of Drosophila 5-HT2AR isoform D coding frameDepositorInsertd5-HT2AR isoform D gRNA2 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-5-HT2AR-isoformBFH
Plasmid#221825PurposePlasmid to express gRNA1 (cgctatcggtctgtgacaga) for editing at the end of Drosophila 5-HT2AR isoforms B, F and H coding frameDepositorInsertd5-HT2AR isoforms BFH gRNA1 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT2AR-isoformBFH
Plasmid#221826PurposePlasmid to express gRNA2 (ggaaaagccgctaattacag) for editing at the end of Drosophila 5-HT2AR isoforms B, F and H coding frameDepositorInsertd5-HT2AR isoforms BFH gRNA2 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterDrosophila U6 promoterAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA-d5-HT7R
Plasmid#221829PurposePlasmid to express gRNA (ggcgagggagagctttctct) for editing at the end of Drosophila 5-HT1AR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
mC4-GFP
Plasmid#221339PurposeExpresses murine homolog of complement 4 fused with GFP under CAG promoterDepositorAvailable SinceAug. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
PX459_NRF2-exon5-1
Plasmid#177781PurposesgRNA for CRISPR/Cas9-mediated deletion of human NRF2DepositorInsertNRF2 (NFE2L2 Human)
UseCRISPRAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
PX459_NRF2-exon5-2
Plasmid#177782PurposesgRNA for CRISPR/Cas9-mediated deletion of human NRF2DepositorInsertNRF2 (NFE2L2 Human)
UseCRISPRAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAGIG-Sema7A-ΔSEMA
Plasmid#190647PurposeExpresses Mouse Sema7A with SEMA domain deletedDepositorAvailable SinceJuly 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAGIG-Sema7A-ΔIG
Plasmid#190648PurposeExpresses Mouse Sema7A with IG Domain DeletedDepositorAvailable SinceJuly 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAGIG-Sema7A-ΔPSI
Plasmid#190649PurposeExpresses Mouse Sema7A with PSI domain deletedDepositorAvailable SinceJuly 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAGIG-Sema7A-KCE
Plasmid#190651PurposeExpresses Mouse Sema7A with RGD motif mutated to KCEDepositorAvailable SinceJuly 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAG-sp-myc-hSema4D
Plasmid#190654PurposeExpresses Human Sema4D with N terminal myc after signal peptideDepositorAvailable SinceJuly 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCS2+ Zf nhsl1b-mNeongreen
Plasmid#233883PurposemNeongreen tagged form of zebrafish nhsl1b. For in vitro transcription (SP6) or expression through CMV.DepositorInsertnhsl1b (nhsl1b Zebrafish)
UseIn vitro synthesis of mrnaTagsmNeongreenExpressionMammalianAvailable SinceJuly 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-fDIO(SERT-HA)-3xmiR122-WPRE-HGHpA
Plasmid#220937PurposeFLP-dependent serotonin transporter overexpression vector for non-invasive gap junction tracingDepositorAvailable SinceJuly 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
EW375 (PB) (ZNF35/IKZF1tar-6bp spacers)x4-H2B-BFP insul CMV-TO-GFP-deimlink-NZF
Plasmid#236177PurposePiggyBac-integrated plasmid containing hygromycin resistance gene, ZNF35/IKZF1-driven BFP, and GFP-NZF dummy transcription factorDepositorInsertsTagsmTagBFP2ExpressionMammalianPromoterCMV and four ZNF35/IKZF1 sitesAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
EW371 (PB) (ZNF35/ZNF35tar-6bp spacers)x4-H2B-BFP insul CMV-TO-ZNF35(5-8)-ZNF35(5-8)-deimlink-NZF
Plasmid#236173PurposePiggyBac-integrated plasmid containing hygromycin resistance gene, ZNF35/ZNF35-driven BFP, and ZNF35/ZNF35-NZF transcription factorDepositorInsertsTagsmTagBFP2ExpressionMammalianPromoterCMV and four ZNF35/ZNF35 sitesAvailable SinceMay 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
EW370 (PB) (ZNF35/ZNF250tarv3-6bp spacers)x4-H2B-BFP insul CMV-TO-ZNF35(5-8)-ZNF250(1-4)-deimlink-NZF
Plasmid#236172PurposePiggyBac-integrated plasmid containing hygromycin resistance gene, ZNF35/ZNF250-driven BFP, and ZNF35/ZNF250-NZF transcription factorDepositorInsertsTagsmTagBFP2ExpressionMammalianPromoterCMV and four ZNF35/ZNF250 sitesAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
EW373 (PB) (ZNF35/ZNF250tarv3-6bp spacers)x4-H2B-BFP insul CMV-TO-GFP-deimlink-NZF
Plasmid#236175PurposePiggyBac-integrated plasmid containing hygromycin resistance gene, ZNF35/ZNF250-driven BFP, and GFP-NZF dummy transcription factorDepositorInsertsTagsmTagBFP2ExpressionMammalianPromoterCMV and four ZNF35/ZNF250 sitesAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
EW489 CMV-TO-ZNF35(5-8)-ZNF250(1-4)-(GGS)x8[G2V G4W S6L G7L G10W G11D G13L G17M G19I G22M G23Q S24Q]-FKBP (FLP-IN)
Plasmid#236147PurposePlasmid encoding the ZNF35/ZNF250 zinc finger array attached by a deimmunized linker to FKBP1A, under control of CMV promoter with two TetR binding sitesDepositorInsertZNF35(5-8)-ZNF250(1-4)-deImmunLink-FKBP
ExpressionMammalianPromoterCMV promoter with two TetR binding sitesAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
EW492 CMV-TO-UTRN-14ZF(N61K,H88F, I91E, K120F)-realdeImmLink-NZF(FLP-IN)
Plasmid#236150PurposeExpress mutated UTRN-14 zinc finger array (N62K, H89F, I91E, K121F) attached by a deimmunized linker to the NZF transcriptional activation under control of CMV promoter with two TetR binding sitesDepositorInsertUTRN-14ZF-deImmLink-NZF
ExpressionMammalianMutationN61K, H88F, I91E, K120F in UTRN-14ZFPromoterCMV promoter with two TetR binding sitesAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
EW488 CMV-TO-NZF-(GGS)x8[G1W S3D S6T G7L S9L G11M G14N G17D G19V G22W]-FRB(T2098L)
Plasmid#236159PurposeExpress NZF transcriptional activation domain fused to a deimmunized linker and mTOR FRB rapamycin binding domain with the T098L mutation, under control of CMV promoter with two TetR binding sitesDepositorInsertNZF-deImmunLink-FRB
ExpressionMammalianMutationT2098L in FRBPromoterCMV promoter with two TetR binding sitesAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
EW499 CMV-TO-NZF-(GGS)x8[G1W S3D S6T G7L S9L G11M G14N G17D G19V G22W]-FRB(N2093W, T2098L)
Plasmid#236146PurposePlasmid encoding the NZF transcriptional activation domain attached by a deimmunized linker to FRB with N2093W and T098L mutations, under control of CMV promoter with two TetR binding sitesDepositorInsertNZF-deImmunLink-FRB
ExpressionMammalianMutationN2093W, T2098L in FRBPromoterCMV promoter with two TetR binding sitesAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
EW446 CMV-TO-ADAR2dd(E488Q, T501A) (FLP-IN)
Plasmid#236125PurposePlasmid encoding free ADAR2dd under control of CMV promoter with two TetR binding sitesDepositorInsertADAR2dd (ADARB1 Synthetic, Human)
ExpressionMammalianMutationE488Q, T501APromoterCMV promoter with two TetR binding sitesAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
EW263 CMV-TO-ADAR2dd(E488Q, T501A)-PUF-9R(FLP-IN)
Plasmid#236126PurposePlasmid encoding ADAR2dd attached to PUF-9R under control of CMV promoter with two TetR binding sitesDepositorInsertADAR2dd-PUF-9R (ADARB1 Synthetic, Human)
ExpressionMammalianMutationE488Q, T501A in ADAR2ddPromoterCMV promoter with two TetR binding sitesAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
EW374 (PB) (ZNF35/ZNF35tar-6bp spacers)x4-H2B-BFP insul CMV-TO-GFP-deimlink-NZF
Plasmid#236176PurposePiggyBac-integrated plasmid containing hygromycin resistance gene, ZNF35/ZNF35-driven BFP, and GFP-NZF dummy transcription factorDepositorInsertsTagsmTagBFP2ExpressionMammalianPromoterCMV and four ZNF35/ZNF35 sitesAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCM100_ PB5'IR-hU6-gRNA-CS1- CAG-tdTomato- PB3'IR
Plasmid#229995PurposePiggyBac sgRNA cloning plasmid with tdTomato reporter with a capture sequence (cs1)DepositorTypeEmpty backboneUseCRISPRTagsNotI site for NEBuilder HiFi DNA Assembly with ss…ExpressionMammalianPromoterCAGAvailable SinceFeb. 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPB9v2
Plasmid#210029PurposeContains cloning site for molecularly-tagged Cas9 gRNA constructs, inducible Cas9, rtTA-T2A-puroDepositorInsertsCas9
rtta-T2A-puro
UseCRISPRTagsSV40 NLS and nucleoplasmin NLSExpressionMammalianPromoterEF-1α and TRE3GAvailable SinceFeb. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPB9P2
Plasmid#210030PurposeContains PE2 prime editing gRNA cloning site, inducible prime editor 2, rtTA-T2A-puroDepositorInsertsprime editor 2
rtta-T2A-puro
UseCRISPRTagsSV40 NLSExpressionMammalianPromoterEF-1α and TRE3GAvailable SinceFeb. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPB758
Plasmid#210033PurposeContains inducible Cas7-P2A-Cas5-T2A-Cas8, rtTA-T2A-puroDepositorInsertsCas7-P2A-Cas5-T2A-Cas8
rtta-T2A-puro
UseCRISPRTagsSV40 NLSExpressionMammalianPromoterEF-1α and TRE3GAvailable SinceFeb. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHIV-EF1a-Il1a-ZsGreen
Plasmid#231987PurposeExpress IL-1alpha-ZsGreen fusion proteinDepositorInsertIL-1alpha-ZsGreen fusion construct
UseLentiviralAvailable SinceJan. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
LC3B-TdLanYFP
Plasmid#228565PurposeEncodes an acceptor-only, TdLanYFP-tagged version of the LC3B biosensor under the control of the CMV promoterDepositorAvailable SinceJan. 9, 2025AvailabilityAcademic Institutions and Nonprofits only