We narrowed to 159,352 results for: addgene
-
Plasmid#219823PurposeEF1α-driven expression of RfxCas13d in mammalian cells. For cloning of pre-guide RNAs compatible with RfxCas13d. Contains a 5' direct repeat. Clone using BsmBI. (Adapted from plasmid #138147)DepositorInsertRfxCas13d
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterEF1a core promoterAvailable sinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSCL391
Plasmid#219501PurposeExpress Ade2 and Faa1 editrons from a single Gal7 promoter, separated by a Csy4 recognition sequenceDepositorInsertEco1 editing ncRNAs and Cas9 gRNAs to edit ADE2 and FAA1
UseTagsExpressionYeastMutationPromoterGAL7Available sinceMay 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
LEGO-pDHS-AP1x6-GM55
Plasmid#217416PurposeLuciferase expression vector with 6 AP-1 sites and the minimal GM-CSF promoter, and a chromatin priming element. Alias: LEGO-GM55-AP-1x6-pDHS(IL-3)DepositorInsertLuciferase, GFP
UseLentiviral and LuciferaseTagsExpressionMammalianMutationPromoter6 AP-1 sites, Human -55 to +28 minimal CSF2 promo…Available sinceMay 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
LEGO-pDHS-ITDE-AP1x6-DUSP5
Plasmid#217419PurposeLuciferase expression vector with an oncogene-inducible enhancer, 6 AP-1 sites, the full length DUSP5 promoter, and a chromatin priming element. Alias: LEGO-DUSP5p-AP-1x6-ITDeDepositorInsertLuciferase, GFP
UseLentiviral and LuciferaseTagsExpressionMammalianMutationPromoterHuman DUSP5 promoterAvailable sinceMay 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 N-terminal sgRNA
Plasmid#207094PurposepX330 based plasmid for expression of Cas9 and the TTACTGCAGAATGACTACAG sgRNA to target the SHLD3 locus.DepositorInsertTTACTGCAGAATGACTACAG
UseTagsExpressionMammalianMutationPromoterCMV and U6Available sinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
NBS1 C-terminal sgRNA
Plasmid#207092PurposepX330 based plasmid for expression of Cas9 and the TAAAAAGGAGAAGATAACTG sgRNA to target the NBS1 locus.DepositorInsertTAAAAAGGAGAAGATAACTG
UseTagsExpressionMammalianMutationPromoterCMV and U6Available sinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
RNF169 C-terminal sgRNA
Plasmid#207099PurposepX330 based plasmid for expression of Cas9 and the ACACTTCATTAGGTGCTACT sgRNA to target the RNF169 locus.DepositorInsertACACTTCATTAGGTGCTACT
UseTagsExpressionMammalianMutationPromoterCMV and U6Available sinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD1 N-terminal sgRNA
Plasmid#207101PurposepX330 based plasmid for expression of Cas9 and the ATGGCAGGACTATGGCAGCC sgRNA to target the SHLD1 locus.DepositorInsertATGGCAGGACTATGGCAGCC
UseTagsExpressionMammalianMutationPromoterCMV and U6Available sinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
ATM C-terminal sgRNA
Plasmid#207097PurposepX330 based plasmid for expression of Cas9 and the TTTCTAAAGGCTGAATGAAA sgRNA to target the ATM locus.DepositorInsertTTTCTAAAGGCTGAATGAAA
UseTagsExpressionMammalianMutationPromoterCMV and U6Available sinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
GOLIM4 g2 LentiCRISPRv2-mCherry
Plasmid#218663PurposeKnockout vector for human GOLIM4 (GPP130/GOLPH4)DepositorInsertGOLIM4 (GOLIM4 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceMay 1, 2024AvailabilityAcademic Institutions and Nonprofits only