We narrowed to 6,981 results for: Mag
-
Plasmid#239574PurposeRibozyme split sfGFP expressionDepositorInsertSuperfolder GFP with ribozyem insertion
UseSynthetic BiologyExpressionPlantAvailable SinceJune 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pXYB031
Plasmid#239577PurposeDeactivated ribozyme split GFPuv expressionDepositorInsertGFPuv coding sequence inserted with deactivated ribozyme
UseSynthetic BiologyExpressionPlantAvailable SinceJune 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV_mutCKAR3
Plasmid#238414PurposeAAV construct with CKAR3 mutant expression under a human synapsin promotor and WPRE3 translation enhancer.DepositorInsertphosphorylation deficient mutant of CKAR3 (T to A)
UseAAVExpressionMammalianAvailable SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pME_Cp_0_5a_005_HA-tag
Plasmid#235887PurposeHA C-tagDepositorInsertHA C-tag
UseSynthetic BiologyAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pME_Cp_0_3b_027_HA-tag
Plasmid#235880PurposeHA N-tagDepositorInsertHA N-tag
UseSynthetic BiologyAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
RNF168 C-terminal sgRNA
Plasmid#207100PurposepX330 based plasmid for expression of Cas9 and the GAGATGCACAAAGTAAGGCC sgRNA to target the RNF168 locus.DepositorInsertGAGATGCACAAAGTAAGGCC
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
RIF C-terminal sgRNA
Plasmid#207096PurposepX330 based plasmid for expression of Cas9 and the AATACTAAATAGAATTTTCA sgRNA to target the RIF1 locus.DepositorInsertAATACTAAATAGAATTTTCA
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
REV7 C-terminal sgRNA
Plasmid#207095PurposepX330 based plasmid for expression of Cas9 and the GCTCATAAAGGCAGCTGAGG sgRNA to target the REV7 locus.DepositorInsertGCTCATAAAGGCAGCTGAGG
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
Halo XLF sgRNA
Plasmid#207605PurposesgRNA for the insert of the HaloTag at the endogenous loci of XLFDepositorInsertGTTCTTCCATctgcaaaaaa
TagsNoneExpressionMammalianAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
HaloXRCC4 sgRNA
Plasmid#207606PurposesgRNA for the insert of the HaloTag at the endogenous loci of XRCC4.DepositorInsertTACTGGGTTCAGAAACAAGG
ExpressionMammalianAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only