We narrowed to 64,328 results for: %s
-
Plasmid#176429PurposeExpresses SARS-CoV-2 NTD domain from the P.1 variant with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-NTD-P.1 (S )
TagsAVI, HRV3C, and scFcExpressionMammalianMutationL18F, T20N, P26S, D138Y, R190SAvailable SinceMarch 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-S2P-P.1-AVI
Plasmid#176327PurposeExpresses SARS-CoV-2 S2P protein from the P.1 variant with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-S2P-P.1 (S )
TagsAVI, HRV3C, and scFcExpressionMammalianMutationL18F, T20N, P26S, D138Y, R190S, K417T, E484K, N50…Available SinceMarch 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
PARK7_Halo_C_allele
Plasmid#178165PurposeDonor vector for endogenous tagging of human PARK7 at the C-terminus with halotagInsertHalotag (PARK7 Human)
UseDonor vectorAvailable SinceDec. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRMA154
Plasmid#167554PurposeS. flexneri O antigen genes cloned from pPM2213 into pJRD215DepositorInsertS. flexneri O antigen genes cloned from pPM2213 (ClaI - KpnI)
UseBroad host range mobilisableAvailable SinceMay 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS607c
Plasmid#87409Purposep426_Cas9_gRNA-ARS607c without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS607c
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-CAN1y
Plasmid#87391PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting CAN1y sequence GATACGTTCTCTATGGAGGA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting CAN1y
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS720a
Plasmid#87392PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS720a sequence CAACAATTGTTACAATAGTA in yeast chromosome 7.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS720a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1021b
Plasmid#87395PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1021b sequence CCTCTGTGTGGTGGTAATTG in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1021b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1114a
Plasmid#87397PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1114a sequence CTTGTGAAACAAATAATTGG in yeast chromosome 11.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1114a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1414a
Plasmid#87400PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1414a sequence GCGCCACAGTTTCAAGGGTC in yeast chromosome 14.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1414a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
NG0911 pCI-TPI-SMG5(short)-4H
Plasmid#65805PurposeNMD reporter mRNADepositorInsertTPI (TPI1 Human)
Tags4H (4 copies of short beta-globin 3'UTR for …ExpressionMammalianPromoterCMVAvailable SinceSept. 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
p413GPD-hTPI Lys13Arg
Plasmid#50722Purposeexpression of the human TPI Lys13Arg allele in yeastDepositorInsertTriosephosphate isomerase 1 (TPI1 Human)
ExpressionYeastMutationchanged Lysine 13 to ArgeninePromoterGPDAvailable SinceFeb. 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
p413GPD-hTPI Ile170Thr
Plasmid#50721Purposeexpression of the human TPI Ile170Thr allele in yeastDepositorInsertTriosephosphate isomerase 1 (TPI1 Human)
ExpressionYeastMutationIsoleucine 170 to ThreoninePromoterGPDAvailable SinceFeb. 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
p413GPD-hTPI Ile170Val
Plasmid#50720Purposeexpression of the human TPI Ile170Val allele in yeastDepositorInsertTriosephosphate isomerase 1 (TPI1 Human)
ExpressionYeastMutationIsoleucine 170 to ValinePromoterGPDAvailable SinceFeb. 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
pET20b- hTPI Lys13Arg
Plasmid#50726Purposeoverexpression of the human TPI1 Lys13Arg allele in E.coliDepositorInsertTriosephosphate isomerase 1 (TPI1 Human)
Tags6xHIS tagExpressionBacterialMutationchanged Lysine 13 to ArgeninePromoterT7Available SinceFeb. 1, 2014AvailabilityAcademic Institutions and Nonprofits only -
pET20b- hTPI Ile170Val
Plasmid#50724Purposeoverexpression of the human TPI1 Ile170Val allele in E.coliDepositorInsertTriosephosphate isomerase 1 (TPI1 Human)
Tags6xHIS tagExpressionBacterialMutationchanged Isoleucine 170 to ValinePromoterT7Available SinceJan. 31, 2014AvailabilityAcademic Institutions and Nonprofits only -
-
pRZ314:CMVp-mK2-Ex1-(5'D)-ID-BD6-S(50bp)-pA
Plasmid#251323PurposeExpression of mK2-Ex1 under CMVp promoter for use in synthetic gene circuitsDepositorInsertmK2-Ex1
ExpressionMammalianPromoterCMVpAvailable SinceApril 16, 2026AvailabilityAcademic Institutions and Nonprofits only -
pRZ385:CMVp-EC-Ex1-(5'D)-ID-BD6-S(50bp)-pA
Plasmid#251332PurposeExpression of ECFP-Ex1 under CMVp promoter for use in synthetic gene circuitsDepositorInsertEC-Ex1
ExpressionMammalianPromoterCMVpAvailable SinceApril 16, 2026AvailabilityAcademic Institutions and Nonprofits only -
pKR78:SSX1p-mK2-Ex1-(5'D)-ID-BD6-S (50bp)-pA
Plasmid#251288PurposeTrans-splicing expression of mK2-Ex1 under SSX1p promoter for use in synthetic gene circuitsDepositorInsertmK2-Ex1
ExpressionMammalianPromoterSSX1pAvailable SinceApril 16, 2026AvailabilityAcademic Institutions and Nonprofits only