...seconds. Incubate sample(s) for 15 minutes on ice and centrifuge the sample(s) for 15 minutes at 12,000...mL of Solution D per 1 X 10 7 cells. Allow sample(s) to sit at room temperature for 5 minutes to allow...the cells. Extract RNA from the homogenized sample(s).Transfer tissue/cell lysate to a 4 mL tube. Add the...aiming your tip in the tube. Precipitate your sample(s). You can use either Isopropanol or Lithium Chloride...Quantify and assess the quality of your RNA sample(s) using a spectrophotometer (such as a Nanodrop), agarose...which can be modified for RNA. Store your RNA sample(s) at -80 °C to prevent RNA degradation and avoid multiple... 1 mL of TRIzol® per 1 X 10 7 cells. Allow sample(s) to sit at room temperature for 5 minutes to allow...

...tube combine the following: DNA Restriction Enzyme(s) Buffer BSA (if recommended by manufacturer) dH 2 ...purifying it, you may need to inactivate the enzyme(s) following the digestion reaction. This may involve...digesting a large number of plasmids with the same enzyme(s) (for instance, in a diagnostic digest), you can create...

...tube of 6 mL BCD TFX. Cap the tube and vortex for 5 s to mix. Add 450 µL of 1 mg/mL PEI-MAX to the second..., 450 µg = 450 µL). Cap the tube and vortex for 5 s to mix. *Pro-Tip* The optimal ratio of DNA:PEI may...diluted DNA. Cap the tube and vortex with three 1 s pulses. Incubate for 3 min at room temperature. Transfer...

... size insert. By selecting the appropriate enzyme(s), one can either linearize a plasmid to determine ...therefore the only thing left to do is identify the clone(s) in which the insert is in the correct orientation...

...use of phenol red. Image adapted from Zolotukhin, S., et al. "Recombinant adeno-associated virus purification...purified AAV. Left image adapted from Zolotukhin, S., et al. "Recombinant adeno-associated virus purification...

...provided by your sequencing provider. My sequence has “N”s in it- what does that mean? “N” is the letter used...

...41817 cut S. pyogenes 23287722 Church actII-orf4 S. coelicolor ATTACCAGGGACCGGAGTTC 62552 cut S. pyogenes...ade6-L469 S. pombe TCTATTGTTCAGATGCCTTG 52227 cut S. pyogenes 25352017 Zaratiegui ade6-M210 S. pombe TCTATTGTTCAGATGCTTCG... 52226 cut S. pyogenes 25352017 Zaratiegui ade6+ S. pombe TCTATTGTTCAGATGCCTCG 52225 cut S. pyogenes 25352017...70655 cut S. pyogenes 26472758 Sabatini CAN1 S. cerevisiae GATACGTTCTCTATGGAGGA 43803 cut S. pyogenes ...interfere S. pyogenes 23849981 Qi CYC1m promoter S. cerevisiae ACAGAGCACATGCATGCCAT 64385 activate S. pyogenes...promoter S. cerevisiae ACTAATACTTTCAACATTTT 64387 activate S. pyogenes 23977949 Lu CYC1m promoter S. cerevisiae...activate S. pyogenes 23977949 Lu CYC1m promoter S. cerevisiae ATATTCTTTCCTTATACATT 64380 activate S. pyogenes...

...none S. pyogenes Gao pZmU3-gRNA 53061 Plant none S. pyogenes Gao pU6-gRNA 53062 Plant BbsI none S. pyogenes...vector was designed to be used with, such as S. pyogenes, S. aureus, N. meningitidis, etc. gRNA scaffolds...Bacteria BsaI none S. pyogenes Chloramphenicol Marraffini pCas9 42876 Bacteria BsaI yes, cut S. pyogenes Chloramphenicol...HindIII none S. pyogenes Qi pDD162 (Peft-3::Cas9 + Empty sgRNA) 47549 C. elegans yes, cut S. pyogenes Goldstein.... elegans BsaI none S. pyogenes Joung pCFD3-dU6:3gRNA 49410 Drosophila BbsI none S. pyogenes Virmilion...BspQI yes, cut S. pyogenes Puro Liu pCFD4-U6:1_U6:3tandemgRNAs 49411 Drosophila BbsI none S. pyogenes Virmilion...Mammalian AfIII none S. pyogenes Bleocin Church MLM3636 43860 Mammalian BsmBI none S. pyogenes Joung pSPgRNA...

...none S. pyogenes Chen pCBC-MT3T4 see paper BsaI none S. pyogenes Chen pBUN421 TaU3 BsaI yes, cut S. pyogenes...AarI none S. pyogenes Gao pZmU3-gRNA maize U3 none S. pyogenes Gao pU6-gRNA wheat U6 BbsI none S. pyogenes...BbsI none S. pyogenes Stupar pBUE411 OsU3 yes, cut S. pyogenes Basta Chen pHUE411 OsU3 yes, cut S. pyogenes...pICSL01009::AtU6p aU6 BsaI none S. pyogenes Kamoun pUC119-gRNA U6 PCR template none S. pyogenes Sheen pRGEB31 ...rice snoRNA U3 BsaI none S. pyogenes Yang pBUN6A11 OsU3 BsaI yes, activate S. pyogenes Bar Chen pBUN6I11...OsU3 BsaI yes, interfere S. pyogenes Bar Chen pBUN501 AtU6-26 BsaI yes, nick S. pyogenes Bar Chen pCBC-...Chen pHAtC U6 AarI yes, cut S. pyogenes Hygro Kim pBAtC U6 AarI yes, cut S. pyogenes Basta Kim pHEE401...

...Expresses the S. pyogenes sgRNA from the H1 promoter. 53187 pmU6-gRNA : Expresses the S. pyogenes sgRNA...Expresses the S. pyogenes sgRNA from the human U6 promoter. 53189 ph7SK-gRNA : Expresses the S. pyogenes ...optimized S. pyogenes Cas9 and GFP. 53191 pLV hUbC-dCas9-T2A-GFP : Co-expresses human optimized S. pyogenes...Plasmid 47106 pcDNA-dCas9 : Expresses inactivated S. pyogenes dCas9 (D10A, H840A) in mammalian cells. .... 47107 pcDNA-dCas9-VP64 : Expresses inactivated S. pyogenes dCas9 (D10A, H840A) fused to VP64 transactivator...domain in mammalian cells. 47108 pSPgRNA : Expresses a S. pyogenes Cas9/dCas9 guide RNA in mammalian cells....hUbC-dCas9 VP64-T2A-GFP : Co-expresses human optimized S. pyogenes dCas9-VP64 and GFP...

... ID Name Promoter Fluorophore Serotype(s) PI 50363 AAV phSyn1(S)-DreO-bGHpA Syn none 5, rg* Zeng Flpo ... ID Name Promoter Fluorophore Serotype(s) PI 51669 AAV phSyn1(S)-FlpO-bGHpA hSyn none rg* Zeng 55634 pAAV-EF1a-mCherry-IRES-Flpo...VCre AAV ID Name Promoter Fluorophore/Tag Serotype(s) PI 55638 pAAV-EF1a-vCre EF1a none 8, rg* Deisseroth...Cre AAV ID Name Promoter Fluorophore/Tag Serotype(s) PI CaMKII Promoter 105551 pENN.AAV.CamKII.HI.GFP-...Recombinases ID Name Promoter Fluorophore Serotype(s) PI 140135 pAAV-EF1a-iCreV EF1a none 1, PHPeB Zeng...

...it grows fast to boot. The yeast strains S. cerevisiae and S. pombe have dominated the research scene....the most frequently used yeast strains: S. pombe (fission) and S. cerevisiae (budding). Yeast make for ...probably wondering if the “biotech yeast” is S. pombe or S. cerevisiae. Actually, it’s neither. The most...phaffii and other yeast strains.     S. cerevisiae S. pombe K. phaffii Growth properties ...glycerol). K. phaffii is only distantly related to S. pombe and S. cerevisiae; evolutionarily it evolved much... K. phaffii to work   The yeast giants - S. cerevisiae and S. pombe - aren’t going anywhere anytime soon...Amenable to genetic manipulation The first eukaryote (S. cerevisiae) to have its genome fully sequenced There...

...source. S. cerevisiae  no no   LEU2 L-leucine no S. cerevisiae yes - This can complement leu1- S. pombe...L-hisitidine no S. cerevisiae  no yes   URA3 pyrimidine (uracil) yes - Grow with 5-FOA. S. cerevisiae yes... ura4+. leu1+ L-leucine   S. pombe  no no   ade6+ purine (adenine)   S. pombe  no no   Considerations...are included (reviewed here). Plasmids for use in S. pombe, on the other hand, do not require a well defined...sequence) dictate the replication of these vectors. S. pombe plasmids oftentimes utilize an ARS to aid in... yes - This can complement ura4- S. pombe, but the complementation is weak. yes   LYS2 L-lysine yes ... yes   TRP1 L-tryptophan yes - Grow with 5-FAA. S. cerevisiae no  no TRP1 alters some yeast phenotypes...

...key step is the priming of the S protein by host cell proteases. The S protein of SARS-CoV-2 is primed...Libraries SARS-CoV-2 Spike (S) Ectodomain and RBD Libraries - Libraries of Spike (S) Ectodomain and RBD mutants... MERS CoV, depends on binding of the viral spike (S) protein to cellular receptors. The cellular receptor...Libraries - Yeast surface display libraries of Spike (S) Ectodomain and RBD mutants that can be used to identify...TMPRSS2 - a serine protease that primes the SARS-CoV-2 S protein and is involved in virus entry into cells....proteins to a biologically active state. The SARS-CoV-2 S protein contains a potential cleavage site for furin...immunoglobulin superfamily, binds to the SARS-CoV-2 S protein and is involved in virus entry into cells....

... Ishiguro S, Gao L, Hirano S, Okazaki S, Noda T, Abudayyeh OO, Gootenberg JS, Mori H, Oura S, Holmes B.... One method uses orthogonal dCas9’s (e.g., S. pyogenes dCas9 and S. aureus dCas9) tagged with different...Chavez A, Scheiman J, Vora S, Pruitt BW, Tuttle M, P R Iyer E, Lin S, Kiani S, Guzman CD, Wiegand DJ, Ter-Ovanesyan...endogenous gene(s) without permanently modifying the genome dCas9-activator (such as dCas9-VP64) gRNA(s) targeting...AHY, Menoret S, Brion A, Lamribet K, Dardillac E, Boix C, Perrouault L, Tesson L, Geny S, De Cian A, Itier...Reyes-Gutierrez P, Wolfe SA, Zhang S, Pederson T. Proc Natl Acad Sci U S A . 112(10):3002-7. PMID: 25713381...Overview Class 2 C lustered R egularly I nterspaced S hort P alindromic R epeat (CRISPR) systems, which ...

...rearrangements in the S. cerevisiae lineage (7). In our class research project, students transform S. cerevisiae...plasmids carrying MET/Met genes from either S. pombe or S. cerevisiae. Students then determine if expression...shown that most, but not all, S. pombe Met genes complement the corresponding S. cerevisiae met deficiencies...strains is available (6). Methionine synthesis in S. cerevisiae (Figure 1) occurs through a well-characterized..., have the same function as their counterparts in S. cerevisiae. The two yeasts are thought to have diverged... the plasmids in either E. coli (ori and ampR) or S. cerevisiae (2µm ori and URA3). The presence of the...successfully transformed with the plasmids, because the S. cerevisiae deletion strains are ∆ura3 mutants and...

...Addgene. Kim D, Kim J, Hur JK, Been KW, Yoon S, Kim J-S (2016) Genome-wide analysis reveals specificities...Cho H-Y, Song DW, Lee KJ, Jung MH, Kim S, Kim JH, Kim JH, Kim J-S (2017) In vivo genome editing with a ...sequences While PAM sequences for the commonly used S. pyogenes Cas9 (3'-NGG) are abundant throughout the...to circumvent this limitation: 1) the use of novel S. pyogenes Cas9 variants with varying PAM sequences... of Cas9 homologs derived from species other than S. pyogenes, and 3) the use of non-Cas9 enzymes. (For...site, check out this video from IGI!) Synthetic S. pyogenes Cas9s with novel PAM recognition In 2015...selection screens in bacteria to identify mutants of S. pyogenes Cas9 that were able to cleave target DNA...

...and happy optimizing!  Recommended Reading Issa, S. S., Shaimardanova, A. A., Solovyeva, V. V., & Rizvanov...Resources References Aschauer, D. F., Kreuz, S., & Rumpel, S. (2013). Analysis of Transduction Efficiency...10.1089/hum.2009.169 Dudek, A. M., Pillay, S., Puschnik, A. S., Nagamine, C. M., Cheng, F., Qiu, J., Carette... https://doi.org/10.1038/s41434-019-0075-6 Issa, S. S., Shaimardanova, A. A., Solovyeva, V. V., & Rizvanov...10.1371/journal.pone.0076310 Damdindorj, L., Karnan, S., Ota, A., Hossain, E., Konishi, Y., Hosokawa, Y.,...Fong, D. M., Mouravlev, A., Young, D., & O’Carroll, S. J. (2019). Astrocyte-selective AAV gene therapy through...cells12050785 Kanaan, N. M., Sellnow, R. C., Boye, S. L., Coberly, B., Bennett, A., Agbandje-McKenna, M...

...depletion assay to discover FnCpf1’s PAM sequence requirements. Cpf1’s preferred PAM is 5’-TTN, differing...RuvC-like endonuclease domain, but they lack Cas9’s second HNH endonuclease domain. Cpf1 cleaves DNA in... RuvC-like endonuclease domain, but it lacks Cas9’s other HNH endonuclease domain, indicating that Cpf1... nuclease could potentially overcome some of Cas9’s shortcomings - namely its blunt double stranded cleavage...nucleotides in length, about the same size as Cas9’s, but with the direct repeat preceding the spacer rather...crRNA is also much simpler in structure than Cas9’s; only a short stem-loop structure in the direct repeat... added another option to the CRISPR toolbox. Cpf1’s staggered cleavage pattern opens up the possibility...

...integrate protein tags into the genomes of S. cerevisiae and S. pombe. The protocol is surprisingly simple...Yeast-optimized fluorophores for imaging Lee S, et al. (2013) PLoS ONE 8(7): e67902. Many imaging...al.(1) assessed many of these fluorescent tags in S. cerevisiae, looking at their performance in categories...plasmids for a wide variety of genome modifications in S. Pombe, including full and partial gene deletion, ...describe a complimentary set of plasmids for use in S. cerevisiae, with the additional benefit of multiple...system that isn't mentioned here? References: Lee S, Lim WA, Thorn KS. PLoS One. 2013 Jul 2;8(7):e67902...