Skip to main content
Addgene
Showing: 1 - 20 of 62 results
  1. Validated gRNA Sequences

    Type
    Collection
    ...41817 cut S. pyogenes 23287722 Church actII-orf4 S. coelicolor ATTACCAGGGACCGGAGTTC 62552 cut S. pyogenes...ade6-L469 S. pombe TCTATTGTTCAGATGCCTTG 52227 cut S. pyogenes 25352017 Zaratiegui ade6-M210 S. pombe TCTATTGTTCAGATGCTTCG... 52226 cut S. pyogenes 25352017 Zaratiegui ade6+ S. pombe TCTATTGTTCAGATGCCTCG 52225 cut S. pyogenes 25352017...70655 cut S. pyogenes 26472758 Sabatini CAN1 S. cerevisiae GATACGTTCTCTATGGAGGA 43803 cut S. pyogenes ...interfere S. pyogenes 23849981 Qi CYC1m promoter S. cerevisiae ACAGAGCACATGCATGCCAT 64385 activate S. pyogenes...promoter S. cerevisiae ACTAATACTTTCAACATTTT 64387 activate S. pyogenes 23977949 Lu CYC1m promoter S. cerevisiae...activate S. pyogenes 23977949 Lu CYC1m promoter S. cerevisiae ATATTCTTTCCTTATACATT 64380 activate S. pyogenes...
  2. CRISPR Plasmids - Empty gRNA Vectors

    Type
    Collection
    ...none S. pyogenes Gao pZmU3-gRNA 53061 Plant none S. pyogenes Gao pU6-gRNA 53062 Plant BbsI none S. pyogenes...vector was designed to be used with, such as S. pyogenes, S. aureus, N. meningitidis, etc. gRNA scaffolds...Bacteria BsaI none S. pyogenes Chloramphenicol Marraffini pCas9 42876 Bacteria BsaI yes, cut S. pyogenes Chloramphenicol...HindIII none S. pyogenes Qi pDD162 (Peft-3::Cas9 + Empty sgRNA) 47549 C. elegans yes, cut S. pyogenes Goldstein.... elegans BsaI none S. pyogenes Joung pCFD3-dU6:3gRNA 49410 Drosophila BbsI none S. pyogenes Virmilion...BspQI yes, cut S. pyogenes Puro Liu pCFD4-U6:1_U6:3tandemgRNAs 49411 Drosophila BbsI none S. pyogenes Virmilion...Mammalian AfIII none S. pyogenes Bleocin Church MLM3636 43860 Mammalian BsmBI none S. pyogenes Joung pSPgRNA...
  3. CRISPR Plasmids - Plants

    Type
    Collection
    ...:AtU6p aU6 BsaI none S. pyogenes Kamoun 52255 pUC119-gRNA U6 PCR template none S. pyogenes Sheen 51295...rice snoRNA U3 BsaI none S. pyogenes Yang 50579 pBUN6A11 OsU3 BsaI yes, activate S. pyogenes Bar Chen 50580... BsaI yes, interfere S. pyogenes Bar Chen 50582 pBUN501 AtU6-26 BsaI yes, nick S. pyogenes Bar Chen 50594...pCBC-MT2T3 see paper BsaI none S. pyogenes Chen 50595 pCBC-MT3T4 see paper BsaI none S. pyogenes Chen 62204 pBUN421...pBUN421 TaU3 BsaI yes, cut S. pyogenes Bar Chen 53063 pU3-gRNA OsU3 AarI none S. pyogenes Gao 53061 pZmU3...pZmU3-gRNA maize U3 none S. pyogenes Gao 53062 pU6-gRNA wheat U6 BbsI none S. pyogenes Gao 59188 pBlu/gRNA...gRNA Arabidopsis U6 BbsI none S. pyogenes Stupar 62200 pBUE411 OsU3 yes, cut S. pyogenes Basta Chen 62203...
  4. CRISPR Guide

    Type
    Collection
    ...23287722 Makarova, K. S., Wolf, Y. I., Alkhnbashi, O. S., Costa, F., Shah, S. A., Saunders, S. J., Barrangou,...Ishiguro, S., Gao, L., Hirano, S., Okazaki, S., Noda, T., Abudayyeh, O. O., Gootenberg, J. S., Mori, H...Chandrasekaran, S. S., Perry, N. T., Schaepe, J., Du, P. P., Lotfy, P., Bassik, M. C., Bintu, L., Bhatt, A. S., & ...PMID: 38216671 Klompe, S. E., Vo, P. L. H., Halpin-Healy, T. S., & Sternberg, S. H. (2019). Transposon-encoded...Scheiman, J., Vora, S., Pruitt, B. W., Tuttle, M., Iyer, E. P. R., Lin, S., Kiani, S., Guzman, C. D., Wiegand..., E. C., Newberry, K. M., Smith, S. B., Meadows, S. K., Roberts, B. S., Mackiewicz, M., Mendenhall, E....Gootenberg, J. S., Abudayyeh, O. O., Slaymaker, I. M., Makarova, K. S., Essletzbichler, P., Volz, S. E., Joung...
  5. Recombinases AAV Preps

    Type
    Collection
    ... ID Name Promoter Fluorophore Serotype(s) PI 50363 AAV phSyn1(S)-DreO-bGHpA Syn none 5, rg* Zeng Flpo ... ID Name Promoter Fluorophore Serotype(s) PI 51669 AAV phSyn1(S)-FlpO-bGHpA Syn none rg* Zeng 174378 pAAV-syn-Flpo...VCre AAV ID Name Promoter Fluorophore/Tag Serotype(s) PI 55638 pAAV-EF1a-vCre EF1a none 8, rg* Deisseroth...Cre AAV ID Name Promoter Fluorophore/Tag Serotype(s) PI 105551 pENN.AAV.CamKII.HI.GFP-Cre.WPRE.SV40 CamKII...Recombinases ID Name Promoter Fluorophore Serotype(s) PI 140135 pAAV-EF1a-iCreV EF1a none 1, PHPeB Zeng...
  6. COVID-19 Resources

    Type
    Collection
    ...key step is the priming of the S protein by host cell proteases. The S protein of SARS-CoV-2 is primed...Libraries SARS-CoV-2 Spike (S) Ectodomain and RBD Libraries - Libraries of Spike (S) Ectodomain and RBD mutants... MERS CoV, depends on binding of the viral spike (S) protein to cellular receptors. The cellular receptor...Libraries - Yeast surface display libraries of Spike (S) Ectodomain and RBD mutants that can be used to identify...TMPRSS2 - a serine protease that primes the SARS-CoV-2 S protein and is involved in virus entry into cells....proteins to a biologically active state. The SARS-CoV-2 S protein contains a potential cleavage site for furin...immunoglobulin superfamily, binds to the SARS-CoV-2 S protein and is involved in virus entry into cells....
  7. Allen Institute for Brain Science AAV Enhancer Collection

    Type
    Collection
    ...Opitz-Araya X, Roth JR, Allen S, Ayala A, Bakken TE, Barcelli T, Barta S, Bendrick J, Bertagnolli D, Bowlus...Hockemeyer D, Huang C, Huff S, Hunker A, Johansen N, Juneau Z, Kalmbach B, Khem S, Kussick E, Kutsal R, Larsen...Ronellenfitch K, Mufti S, Sunkin SM, Smith KA, Esposito L, Waters J, Thyagarajan B, Yao S, Lein ES, Zeng H,...observed Publications Ben-Simon Y, Hooper M, Narayan S, Daigle T, Dwivedi D, Way SW, Oster A, Stafford DA...Casper T, Chakka AB, Chakrabarty R, Chance RK, Chavan S, Departee M, Donadio N, Dotson N, Egdorf T, Gabitto...V, Oyama A, Pham T, Pom CA, Potekhina L, Ransford S, Rette D, Rimorin C, Rocha D, Ruiz A, Sanchez REA,... N, Shulga L, Sigler AR, Siverts LA, Somasundaram S, Stewart K, Szelenyi E, Tieu M, Trader C, van Velthoven...
  8. CRISPR References and Information

    Type
    Collection
    ...that identifies putative target sites for S. pyogenes Cas9, S. thermophilus Cas9, or Cpf from your input...checks for off-target binding and can work for S. pyogenes, S. thermophilus or N. meningitidis Cas9 PAMs....position of the observed mutations. Coding sequence/s may be provided to quantify frameshift and potential...support for bacteria ( E. coli, B. subtilis ), yeast ( S. cerevisiae ), worm ( C. elegans ), fruit fly, zebrafish...and news featured on Addgene's blog Protocols Lab(s) Description Plasmids in protocol Download protocol...gRNA: pSimpleII-U6-tracr-U6-BsmBI-NLS-NmCas9-HA-NLS(s) PDF 47.5 KB Vosshall and Matthews CRISPR/Cas9 reagent...
  9. p53 Pathway

    Type
    Collection
    ...ageing-associated phenotypes. Tyner SD, Venkatachalam S, Choi J, Jones S, Ghebranious N, Igelmann H, Lu X, Soron G...papillomavirus). These mutations interfere with p53’s ability to activate transcription, and they also have...through oligomerization. In particular, the loss of p53’s pro-apoptotic effects is especially important to tumorigenesis...kinase ATR ATR serine/threonine kinase B99 G-2 and S-phase expressed 1; also known as GTSE1 BAI-1 Brain-specific... human malignancy: a clinical perspective. Surget S, Khoury MP, Bourdon JC. Onco Targets Ther. 2013 Dec...
  10. CRISPR History and Development for Genome Engineering

    Type
    Collection
    ...(monocots and dicots) C. elegans Yeast ( S. cerevisiae and S. pombe ) Zebrafish Xenopus References Barrangou... Acad Sci U S A . 112(10):3002-7. PMID: 25713381 Ma H, Tu LC, Naseri A, Huisman M, Zhang S, Grunwald D...and number/types of Cas proteins. Makarova et al. ’s classification defines 5 types and 16 subtypes based...PAM, improving targeting in AT-rich genomes. Cpf1's small size also makes it suitable for multiplexing...Fremaux C, Deveau H, Richards M, Boyaval P, Moineau S, Romero DA, Horvath P. 2007. CRISPR provides acquired...12. PMID: 17379808 Bondy-Denomy J, Garcia B, Strum S, Du M, Rollins MF, Hidalgo-Reyes Y, Wiedenheft B, ...407-410. PMID: 28931002 Cong L, Ran FA, Cox D, Lin S, Barretto R, Habib N, Hsu PD, Wu X, Jiang W, Marraffini...
  11. Zhang Lab CRISPR Page

    Type
    Collection
    ... CY, Gootenberg JS, Konermann S, Trevino AE, Scott DA, Inoue A, Matoba S, Zhang Y, Zhang F. Cell . 2013...Mouse CRISPR ( C lustered R egularly I nterspaced S hort P alindromic R epeats) is a microbial nuclease...implemented in mammalian cells by co-expressing the S. pyogenes Cas9 (SpCas9) nuclease along with the guide...The single vector system uses a smaller Cas9 from S. aureus (SaCas9) that has been human codon-optimized...et al., Nature 2015). The dual vector system uses S. pyogenes Cas9 (SpCas9), using one vector to express...using CRISPR/Cas Systems. Cong L, Ran FA, Cox D, Lin S, Barretto R, Habib N, Hsu PD, Wu X, Jiang W, Marraffini...Hsu PD, Scott DA, Weinstein JA, Ran FA, Konermann S, Agarwala V, Li Y, Fine EJ, Wu X, Shalem O, Cradick...
  12. Deisseroth INTRSECT Collection

    Type
    Collection
    ...) Chuhma N, Mingote S, Yetnikoff L, Kalmbach A, Ma T, Ztaou S, Sienna AC, Tepler S, Poulin JF, Ansorge...Link opens in a new window) Mingote S, Amsellem A, Kempf A, Rayport S, Chuhma N. 2020. Dopamine-glutamate...Ansorge M, Awatramani R, Kang UJ, Rayport S. 2018. Dopamine neuron glutamate cotransmission evokes a delayed...Preprint (Link opens in a new window) Yu K, Ahrens S, Zhang X, Schiff H, Ramakrishnan C, Fenno L, Deisseroth...Ramakrishnan C, Fenno L, Deisseroth K, Herry C, Arber S, Lüthi A. 2016. Midbrain circuits for defensive behaviour...
  13. Botman-Teusink Yeast FP Collection

    Type
    Collection
    ... Lee S, Lim WA, Thorn KS. Improved blue, green, and red fluorescent protein tagging vectors for S. cerevisiae...23844123 (Link opens in a new window) Loqué D, Lalonde S, Looger LL, von Wirén N, Frommer WB. A cytosolic trans-activation...
  14. Rinehart Lab Phosphoprotein Reagents

    Type
    Collection
    ..._pSer_Full_library Strain 68306 C321.ΔA.Δserb.Amp S Plasmid 68292 SepOTSλ Plasmid 68307 SupD Plasmid 34623...biological tolerance. Mohler K, Moen JM, Rogulina S, Rinehart J. Mol Syst Biol 2023 Aug 8;19(8):e10591...interactions. Barber KW, Muir P, Szeligowski RV, Rogulina S, Gerstein M, Sampson JR, Isaacs FJ, Rinehart J. Nat...Pirman NL, Barber KW, Ma NJ, Haimovich AD, Rogulina S, Isaacs FJ, and Rinehart J. Nature Communications ... Synthesis. Oza JP, Aerni HR, Pirman NL, Rogulina S, ter Haar CM, Isaacs FJ, Rinehart J, and Jewett MC...deletion. Heinemann IU, Rovner AJ, Aerni HR, Rogulina S, Cheng L, Olds W, Fischer JT, Söll D, Isaacs FJ, Rinehart...
  15. Fujii Lab CRISPR Plasmids

    Type
    Collection
    ...CU, Eriksson P, Veerla S, De Preter K, Speleman F, Fujii H, Påhlman S, Mohlin S. Biochem Biophys Res Commun...line. Fujita T, Kitaura F, Yuno M, Suzuki Y, Sugano S, Fujii H. DNA Res. 2017 Oct 1;24(5):537-548. doi: ...by enChIP-Seq. Fujita T, Yuno M, Suzuki Y, Sugano S, Fujii H. Genes Cells. 2017 Jun;22(6):506-520. doi...
  16. CRISPR Plasmids - Bacteria

    Type
    Collection
    ...Cloning Enzyme(s) Validated In Resistance Co-expressed Cas9 Depositing lab Cas9 species = S. pyogenes (PAM.... coli, S. pneumoniae Kanamycin none, need Cas9 plasmid Marraffini 42876 pCas9 BsaI E. coli, S. pneumoniae...
  17. EXtracellular Plasmid RESource (EXPRESs) Consortium

    Type
    Collection
    ...profiling. Martin S, Söllner C, Charoensawan V, Adryan B, Thisse B, Thisse C, Teichmann S and Wright GJ Molecular...Bartholdson SJ, Bei AK, Theron M, Uchikawa M, Mboup S, Ndir O, Kwiatkowski DP, Duraisingh MT, Rayner JC ...
  18. Bacterial Expression Systems

    Type
    Collection
    ...pPLPCB(s). pJT118 31395 PcpcG2 Green Light (532 nm) Christopher Voigt When combined with pPLPCB(S), encodes...Anhydrotetracycline inducible expression of wild-type Cas9 from S. pyogenes for inducing double stranded breaks. For...and interactions! Plasmid ID Promoter Epitope Tag(s) ID Purpose pDEST-HisMBP 11085 Tac (lactose/IPTG inducible.../protein of interest. Plasmid ID Promoter Inducer(s) PI Purpose Murray Lab pBEST plasmids Various Plasmids...inducible expression of catalytically inactive Cas9 ( S. pyogenes ) which can be combined with expression ...Christopher Voigt When combined with pCph8 and pPLPCB(S), makes lacZ expression inducible by red light. pCph8...
  19. CRISPR Plasmids - Yeast

    Type
    Collection
    ...Cloning Enzyme(s) Validated In Resistance Co-expressed Cas9 Depositing lab Cas9 species = S. pyogenes (PAM...NGG) 49014 pRPR1_gRNA_ handle_RPR1t pRPR1 HindIII S. cerevisiae LEU2 none, need Cas9 plasmid Lu Do you...
  20. CRISPR Plasmids - Xenopus

    Type
    Collection
    ...Cloning Enzyme(s) Delivery Resistance Co-expressed Cas9 Depositing lab Cas9 species = S. pyogenes (PAM...
Showing: 1 - 20 of 62 results