We narrowed to 59 results for: %s
-
TypeCollection...41817 cut S. pyogenes 23287722 Church actII-orf4 S. coelicolor ATTACCAGGGACCGGAGTTC 62552 cut S. pyogenes...ade6-L469 S. pombe TCTATTGTTCAGATGCCTTG 52227 cut S. pyogenes 25352017 Zaratiegui ade6-M210 S. pombe TCTATTGTTCAGATGCTTCG... 52226 cut S. pyogenes 25352017 Zaratiegui ade6+ S. pombe TCTATTGTTCAGATGCCTCG 52225 cut S. pyogenes 25352017...70655 cut S. pyogenes 26472758 Sabatini CAN1 S. cerevisiae GATACGTTCTCTATGGAGGA 43803 cut S. pyogenes ...interfere S. pyogenes 23849981 Qi CYC1m promoter S. cerevisiae ACAGAGCACATGCATGCCAT 64385 activate S. pyogenes...promoter S. cerevisiae ACTAATACTTTCAACATTTT 64387 activate S. pyogenes 23977949 Lu CYC1m promoter S. cerevisiae...activate S. pyogenes 23977949 Lu CYC1m promoter S. cerevisiae ATATTCTTTCCTTATACATT 64380 activate S. pyogenes...
-
CRISPR Plasmids - Empty gRNA Vectors
TypeCollection...none S. pyogenes Gao pZmU3-gRNA 53061 Plant none S. pyogenes Gao pU6-gRNA 53062 Plant BbsI none S. pyogenes...vector was designed to be used with, such as S. pyogenes, S. aureus, N. meningitidis, etc. gRNA scaffolds...Bacteria BsaI none S. pyogenes Chloramphenicol Marraffini pCas9 42876 Bacteria BsaI yes, cut S. pyogenes Chloramphenicol...HindIII none S. pyogenes Qi pDD162 (Peft-3::Cas9 + Empty sgRNA) 47549 C. elegans yes, cut S. pyogenes Goldstein.... elegans BsaI none S. pyogenes Joung pCFD3-dU6:3gRNA 49410 Drosophila BbsI none S. pyogenes Virmilion...BspQI yes, cut S. pyogenes Puro Liu pCFD4-U6:1_U6:3tandemgRNAs 49411 Drosophila BbsI none S. pyogenes Virmilion...Mammalian AfIII none S. pyogenes Bleocin Church MLM3636 43860 Mammalian BsmBI none S. pyogenes Joung pSPgRNA... -
CRISPR Plasmids - Plants
TypeCollection...:AtU6p aU6 BsaI none S. pyogenes Kamoun 52255 pUC119-gRNA U6 PCR template none S. pyogenes Sheen 51295...rice snoRNA U3 BsaI none S. pyogenes Yang 50579 pBUN6A11 OsU3 BsaI yes, activate S. pyogenes Bar Chen 50580... BsaI yes, interfere S. pyogenes Bar Chen 50582 pBUN501 AtU6-26 BsaI yes, nick S. pyogenes Bar Chen 50594...pCBC-MT2T3 see paper BsaI none S. pyogenes Chen 50595 pCBC-MT3T4 see paper BsaI none S. pyogenes Chen 62204 pBUN421...pBUN421 TaU3 BsaI yes, cut S. pyogenes Bar Chen 53063 pU3-gRNA OsU3 AarI none S. pyogenes Gao 53061 pZmU3...pZmU3-gRNA maize U3 none S. pyogenes Gao 53062 pU6-gRNA wheat U6 BbsI none S. pyogenes Gao 59188 pBlu/gRNA...gRNA Arabidopsis U6 BbsI none S. pyogenes Stupar 62200 pBUE411 OsU3 yes, cut S. pyogenes Basta Chen 62203... -
CRISPR Guide
TypeCollection...23287722 Makarova, K. S., Wolf, Y. I., Alkhnbashi, O. S., Costa, F., Shah, S. A., Saunders, S. J., Barrangou,...Ishiguro, S., Gao, L., Hirano, S., Okazaki, S., Noda, T., Abudayyeh, O. O., Gootenberg, J. S., Mori, H...Chandrasekaran, S. S., Perry, N. T., Schaepe, J., Du, P. P., Lotfy, P., Bassik, M. C., Bintu, L., Bhatt, A. S., & ...PMID: 38216671 Klompe, S. E., Vo, P. L. H., Halpin-Healy, T. S., & Sternberg, S. H. (2019). Transposon-encoded...Scheiman, J., Vora, S., Pruitt, B. W., Tuttle, M., Iyer, E. P. R., Lin, S., Kiani, S., Guzman, C. D., Wiegand..., E. C., Newberry, K. M., Smith, S. B., Meadows, S. K., Roberts, B. S., Mackiewicz, M., Mendenhall, E....Gootenberg, J. S., Abudayyeh, O. O., Slaymaker, I. M., Makarova, K. S., Essletzbichler, P., Volz, S. E., Joung... -
COVID-19 Resources
TypeCollection...Kleine-Weber, H., Schroeder, S., Krüger, N., Herrler, T., Erichsen, S., Schiergens, T. S., Herrler, G., Wu, N....key step is the priming of the S protein by host cell proteases. The S protein of SARS-CoV-2 is primed...-2 Spike (S) Ectodomain and RBD Libraries Screening Timothy Whitehead Libraries of Spike (S) Ectodomain..., Hofmann-Winkler, H., Gierer, S., Liepold, T., Jahn, O., & Pöhlmann, S. (2014). TMPRSS2 and ADAM17 cleave... MERS CoV, depends on binding of the viral spike (S) protein to cellular receptors. The cellular receptor...genes encoding SARS-CoV-2 proteins, (spike protein, S; small envelope protein, E; nucleocapsid protein, ...plasmids - a serine protease that primes the SARS-CoV-2 S protein and is involved in virus entry into cells ... -
Recombinases AAV Preps
TypeCollection... ID Name Promoter Fluorophore Serotype(s) PI 50363 AAV phSyn1(S)-DreO-bGHpA Syn none 5, rg* Hongkui Zeng... ID Name Promoter Fluorophore Serotype(s) PI 51669 AAV phSyn1(S)-FlpO-bGHpA Syn none rg* Hongkui Zeng ...Cre AAV ID Name Promoter Fluorophore/Tag Serotype(s) PI 105551 pENN.AAV.CamKII.HI.GFP-Cre.WPRE.SV40 CamKII...Recombinases ID Name Promoter Fluorophore Serotype(s) PI 140135 pAAV-EF1a-iCreV EF1a none 1, PHPeB Hongkui...VCre AAV ID Name Promoter Fluorophore/Tag Serotype(s) PI 55638 pAAV-EF1a-vCre EF1a none 8, rg* Karl Deisseroth... -
Botman-Teusink Yeast FP Collection
TypeCollection...30783202 (Link opens in a new window) Lee, S., Lim, W. A., Thor,n K. S. (2013) Improved blue, green, and red...red fluorescent protein tagging vectors for S. cerevisiae. PLoS One, 8 (7):e67902. https://doi.org/10.1371... (Link opens in a new window) Loqué, D., Lalonde, S., Looger, L. L., von Wirén, N., Frommer, W. B. (2007...Link opens in a new window) Sheff, M. A., Thorn, K. S. (2004). Optimized cassettes for fluorescent protein...Link opens in a new window) Vickers, C. E., Bydder, S. F., Zhou, Y., Nielsen, L. K. (2013). Dual gene expression... -
The Pleiades Promoter Project
TypeCollection...Jiang, S., Khorasan-zadeh, S., Komljenovic, I., Laprise, S., Liao, N. Y., Lim, J. S., Lithwick, S., Liu..., Wong, B. K., Wong, S. H., Wong, T. Y., Yang, G. S., Ypsilanti, A. R., Jones, S. J., Holt, R. A., Goldowitz... Ho Sui, S. J. Fulton, D. L., Ali, J., Amirabbasi, M., Arenillas, D. J., Babyak, N., Black, S. F., Bonaguro...selective expression in the brain. Proc Natl Acad Sci U S A, 107 (38):16589-94. https://doi.org/10.1073/pnas... -
CRISPR References and Information
TypeCollection...identifies putative target sites for S. pyogenes Cas9, S. aureus Cas9, S. thermophilus Cas9, N. meningitidis...checks for off-target binding and can work for S. pyogenes , S. thermophilus , or N. meningitidis Cas9 PAMs...support for bacteria ( E. coli, B. subtilis ), yeast ( S. cerevisiae ), worm ( C. elegans ), fruit fly, zebrafish...to maximize on-target activity for selected target(s). Uses human, mouse, and rat reference genomes. Hosted...forum started by the Feng Zhang Lab . Protocols Lab(s) Description Plasmids in protocol Download protocol...gRNA: pSimpleII-U6-tracr-U6-BsmBI-NLS-NmCas9-HA-NLS(s) PDF, 49 KB Vosshall and Matthews (Link opens in a... -
p53 Pathway
TypeCollection...ageing-associated phenotypes. Tyner SD, Venkatachalam S, Choi J, Jones S, Ghebranious N, Igelmann H, Lu X, Soron G...papillomavirus). These mutations interfere with p53’s ability to activate transcription, and they also have...through oligomerization. In particular, the loss of p53’s pro-apoptotic effects is especially important to tumorigenesis...kinase ATR ATR serine/threonine kinase B99 G-2 and S-phase expressed 1; also known as GTSE1 BAI-1 Brain-specific... human malignancy: a clinical perspective. Surget S, Khoury MP, Bourdon JC. Onco Targets Ther. 2013 Dec... -
CRISPR History and Development for Genome Engineering
TypeCollection...(monocots and dicots) C. elegans Yeast ( S. cerevisiae and S. pombe ) Zebrafish Xenopus References Barrangou... Acad Sci U S A . 112(10):3002-7. PMID: 25713381 Ma H, Tu LC, Naseri A, Huisman M, Zhang S, Grunwald D...and number/types of Cas proteins. Makarova et al. ’s classification defines 5 types and 16 subtypes based...PAM, improving targeting in AT-rich genomes. Cpf1's small size also makes it suitable for multiplexing...Fremaux C, Deveau H, Richards M, Boyaval P, Moineau S, Romero DA, Horvath P. 2007. CRISPR provides acquired...12. PMID: 17379808 Bondy-Denomy J, Garcia B, Strum S, Du M, Rollins MF, Hidalgo-Reyes Y, Wiedenheft B, ...407-410. PMID: 28931002 Cong L, Ran FA, Cox D, Lin S, Barretto R, Habib N, Hsu PD, Wu X, Jiang W, Marraffini... -
Zhang Lab CRISPR Page
TypeCollection... CY, Gootenberg JS, Konermann S, Trevino AE, Scott DA, Inoue A, Matoba S, Zhang Y, Zhang F. Cell . 2013...Mouse CRISPR ( C lustered R egularly I nterspaced S hort P alindromic R epeats) is a microbial nuclease...implemented in mammalian cells by co-expressing the S. pyogenes Cas9 (SpCas9) nuclease along with the guide...The single vector system uses a smaller Cas9 from S. aureus (SaCas9) that has been human codon-optimized...et al., Nature 2015). The dual vector system uses S. pyogenes Cas9 (SpCas9), using one vector to express...using CRISPR/Cas Systems. Cong L, Ran FA, Cox D, Lin S, Barretto R, Habib N, Hsu PD, Wu X, Jiang W, Marraffini...Hsu PD, Scott DA, Weinstein JA, Ran FA, Konermann S, Agarwala V, Li Y, Fine EJ, Wu X, Shalem O, Cradick... -
Rinehart Lab Phosphoprotein Reagents
TypeCollection...Aguiar, M., Beausoleil, S. A., Paulo, J. A., Rinehart, J., Huttlin, E. L., & Gygi, S. P. (2022). A multi-... described in: Mohler, K., Moen, J. M., Rogulina, S., & Rinehart, J. (2023). System‐wide optimization ...Barber, K. W., Muir, P., Szeligowski, R. V., Rogulina, S., Gerstein, M., Sampson, J. R., Isaacs, F. J., & Rinehart...Aerni, H. R., J, N., MA, Haimovich, A. D., Rogulina, S., Isaacs, F. J., & Rinehart, J. (2015). A flexible... N. L., Barber, K. W., Ter Haar, C. M., Rogulina, S., Amrofell, M. B., Isaacs, F. J., Rinehart, J., & ...Heinemann, I. U., Rovner, A. J., Aerni, H. R., Rogulina, S., Cheng, L., Olds, W., Fischer, J. T., Söll, D., Isaacs... -
Deisseroth INTRSECT Collection
TypeCollection...) Chuhma N, Mingote S, Yetnikoff L, Kalmbach A, Ma T, Ztaou S, Sienna AC, Tepler S, Poulin JF, Ansorge...Link opens in a new window) Mingote S, Amsellem A, Kempf A, Rayport S, Chuhma N. 2020. Dopamine-glutamate...Ansorge M, Awatramani R, Kang UJ, Rayport S. 2018. Dopamine neuron glutamate cotransmission evokes a delayed...Preprint (Link opens in a new window) Yu K, Ahrens S, Zhang X, Schiff H, Ramakrishnan C, Fenno L, Deisseroth...Ramakrishnan C, Fenno L, Deisseroth K, Herry C, Arber S, Lüthi A. 2016. Midbrain circuits for defensive behaviour... -
Allen Institute for Brain Science AAV Enhancer Collection
TypeCollection...Ben-Simon, Y., Hooper, M., Narayan, S., Daigle, T. L., Dwivedi, D., Way, S. W., Oster, A., Stafford, D. A....-Araya, X., Roth, J. R., Alexander, J. R., Allen, S., Amster, A., Arbuckle, J., Ayala, A., Baker, P. M...Bendrick, J. L., Kim, T. K., Zhou, T., Mortrud, M., Yao, S., Siverts, L. A., Larsen, R., Gore, B. B., Szelenyi...Johansen, N. J., Hooper, M., Omstead, V., Vargas, S., Lerma, M. N., Taskin, N., Weed, N., Laird, W. D....Ben-Simon, Y., Opitz-Araya, X., Martinez, R. A., Way, S. W., Thyagarajan, B., . . . Ting, J. T. (2025). Enhancer...Mahoney, J. T., Kojima, Y., Ding, Y., Somasundaram, S., Miller, J. A., Kalmbach, B. E., Radaelli, C., Gore...Shapovalova, N. V., Martinez, R. A., Fong, O., Yao, S., Mortrud, M., . . . Levi, B. P. (2021). Functional... -
CRISPR Plasmids - Bacteria
TypeCollection...Cloning Enzyme(s) Validated In Resistance Co-expressed Cas9 Depositing lab Cas9 species = S. pyogenes (PAM.... coli, S. pneumoniae Kanamycin none, need Cas9 plasmid Marraffini 42876 pCas9 BsaI E. coli, S. pneumoniae... -
Tetracycline Inducible Expression
TypeCollection...Gossen, M., Bujard, H., & Reed, S. I. (1994). Acceleration of the G1/S phase transition by expression ...transactivator (rtTA-Advanced, also known as rtTA2 S -M2) with greater sensitivity to doxycycline and three...tetracycline-responsive promoters . Proc Natl Acad Sci U S A, 89 (12), 5547–5551. https://doi.org/10.1073/pnas...Link opens in a new window) Gossen, M., Freundlieb, S., Bender, G., Müller, G., Hillen, W., & Bujard, H....PMID: 8114703 (Link opens in a new window) Urlinger, S., Baron, U., Thellmann, M., Hasan, M. T., Bujard, ...expanded range and sensitivity . Proc Natl Acad Sci U S A, 97 (14), 7963–7968. https://doi.org/10.1073/pnas... -
CRISPR Plasmids - Yeast
TypeCollection...Cloning Enzyme(s) Validated In Resistance Co-expressed Cas9 Depositing lab Cas9 species = S. pyogenes (PAM...NGG) 49014 pRPR1_gRNA_ handle_RPR1t pRPR1 HindIII S. cerevisiae LEU2 none, need Cas9 plasmid Lu Do you... -
Plan Your Experiment
TypeCollection...designed your gRNA(s), the next step is to choose how to express your Cas enzyme and gRNA(s) in your target...., Adamson, B., Norman, T. M., Lander, E. S., Weissman, J. S., Friedman, N., & Regev, A. (2016). Perturb-Seq...Ploegh, H. L., Bassik, M. C., Qi, L. S., Kampmann, M., & Weissman, J. S. (2014). Genome-Scale CRISPR-Mediated...References CRISPR ( C lustered R egularly I nterspaced S hort P alindromic R epeats) is a powerful system that...generally only compatible with smaller Cas enzymes, like S. aureus Cas9. For more information, see our blog post... -
Fluorescent Proteins: FRET
TypeCollection...BRET assays. References Bajar, B. T., Wang, E. S., Zhang, S., Lin, M. Z., & Chu, J. (2016). A Guide to Fluorescent...new window) Algar, W. R., Hildebrandt, N., Vogel, S. S., & Medintz, I. L. (2019). FRET as a biomolecular...