We narrowed to 12 results for: %s
-
TypeGuide...23287722 Makarova, K. S., Wolf, Y. I., Alkhnbashi, O. S., Costa, F., Shah, S. A., Saunders, S. J., Barrangou,...Ishiguro, S., Gao, L., Hirano, S., Okazaki, S., Noda, T., Abudayyeh, O. O., Gootenberg, J. S., Mori, H...Chandrasekaran, S. S., Perry, N. T., Schaepe, J., Du, P. P., Lotfy, P., Bassik, M. C., Bintu, L., Bhatt, A. S., & ...PMID: 38216671 Klompe, S. E., Vo, P. L. H., Halpin-Healy, T. S., & Sternberg, S. H. (2019). Transposon-encoded...Scheiman, J., Vora, S., Pruitt, B. W., Tuttle, M., Iyer, E. P. R., Lin, S., Kiani, S., Guzman, C. D., Wiegand..., E. C., Newberry, K. M., Smith, S. B., Meadows, S. K., Roberts, B. S., Mackiewicz, M., Mendenhall, E....Gootenberg, J. S., Abudayyeh, O. O., Slaymaker, I. M., Makarova, K. S., Essletzbichler, P., Volz, S. E., Joung...
-
Modular Cloning Guide
TypeGuide...Laboratory Weber E, Engler C, Gruetzner R, Werner S, Marillonnet S. A modular cloning system for standardized... Gruetzner R, Ehnert TM, Werner S, Jones JD, Patron NJ, Marillonnet S. A golden gate modular cloning toolbox...vectors specific for tobacco ( N. tabacum ) or potato ( S. tuberosum ). Joint Modular Cloning (JMC) Toolkit ... assembly of single and multi-gene constructs for S. cerevisiae expression. Multiplex Yeast Toolkit (MYT...the MoClo-YTK (Dueber) for genetic engineering of S. cerevisiae , enabling larger multi-gene constructs...transcription units for protein secretion in yeasts S. cerevisiae and P. pastoris (a.k.a. K. phaffii ). ... plasmids for genome integration in fission yeast S. pombe . These can be used with plasmids from the ... -
Adenovirus Guide
TypeGuide...Adenoviral Vector topics References Ahi, Y. S., Bangari, D. S., & Mittal, S. K. (2011). Adenoviral vector immunity...) Ewer, K. J., Sebastian, S., Spencer, A. J., Gilbert, S. C., Hill, A. V. S., & Lambe, T. (2017). Chimpanzee... new window) Lee, C. S., Bishop, E. S., Zhang, R., Yu, X., Farina, E. M., Yan, S., Zhao, C., Zheng, Z....J., Stanley, D., Honko, A., Johnson, J., Mulangu, S., Pau, M. G., Custers, J., Vellinga, J., Hendriks,...PMID: 21325402 (Link opens in a new window) Gilbert, S. C. (2015). Adenovirus-vectored Ebola vaccines . Expert...26289977 (Link opens in a new window) He, T. C., Zhou, S., da Costa, L. T., Yu, J., Kinzler, K. W., & Vogelstein... Li, Y., Zhang, W., Yang, C., Wu, K., Wu, Y., Ho, S., Athiviraham, A., Lee, M. J., Wolf, J. M., Reid, ... -
Gamma-Retroviral Vector Guide
TypeGuide...Ravin, S. S., Su, L., Theobald, N., Choi, U., Macpherson, J. L., Poidinger, M., Symonds, G., Pond, S. M.,..., Abreu, S., Rubat, L., Nikoniuk, A., Macmorland, W., Horlock, C., Matsumoto, S., Williams, S., Smith,...Viral Protocols References Coffin, J. M., Hughes, S. H., & Varmus, H. E. (Eds.). (1997). Principles of...., Ferris, A. L., Hughes, S. H., Malech, H. L., & Wu, X. (2014). Enhancers are major targets for murine...., Wolfsberg, T. G., Baxevanis, A. D., & Burgess, S. M. (2014). MLV integration site selection is driven...Smith, K., Price, J., Srivastava, S., Hussain, R., Banani, M. A., Day, W., Stevenson, E., Madigan, M., Chen...doi.org/10.3390/v13081471 PMID: 34452336 Schnierle, B. S., Stitz, J., Bosch, V., Nocken, F., Merget-Millitzer... -
Lentiviral Vector Guide
TypeGuide... Kim, H. S., Hwang, G., Lee, H. K., Bae, T., Park, S., Kim, Y. J., Lee, S., Park, J., Bae, S., & Hur, ..., J. N., Norberg, S. M., Hinrichs, C., Highfill, S. L., Somerville, R. P., Panch, S. R., Jin, P., & Stroncek...36348415 Stewart, S. A., Dykxhoorn, D. M., Palliser, D., Mizuno, H., Yu, E. Y., An, D. S., Sabatini, D. ...30518911 Wells, D. W., Guo, S., Shao, W., Bale, M. J., Coffin, J. M., Hughes, S. H., & Wu, X. (2020). An ...10.1128/jvi.72.11.8463-8471.1998 PMID: 9765382 Durand, S., & Cimarelli, A. (2011). The inside out of lentiviral...., Edavettal, J. M., Swaminathan, T. A., & Braun, S. E. (2021). HIV-based lentiviral vectors: Origin and...Hartenian, E., Shi, X., Scott, D. A., Mikkelsen, T. S., Heckl, D., Ebert, B. L., Root, D. E., Doench, J.... -
Sequencing Primers
TypeGuide...Invitrogen) S. cerevisiae GAL1 promoter, forward primer Gal10pro-F GGTGGTAATGCCATGTAATATG (Stratagene) S. cerevisiae... 5' GGGCTGGCAAGCCACGTTTGGTG 3' end of glutathione-S-transferase, forward primer SP6 ATTTAGGTGACACTATAG... reverse primer GPDpro-F CGGTAGGTATTGATTGTAATTCTG S. cerevisiae GPD promoter, forward primer GW-3' GCATGATGACCACCGATATG...promoter, forward primer Nmt1-F GCAATGTGCAGCGAAACTAA S. pombe nmt1 promoter, forward primer OpIE2 Forward... 5' GGGCTGGCAAGCCACGTTTGGTG 3' end of glutathione-S-transferase, forward primer pGP704-R AACAAGCCAGGGATGTAACG... -
Plan Your Experiment
TypeGuide...designed your gRNA(s), the next step is to choose how to express your Cas enzyme and gRNA(s) in your target...., Adamson, B., Norman, T. M., Lander, E. S., Weissman, J. S., Friedman, N., & Regev, A. (2016). Perturb-Seq...Ploegh, H. L., Bassik, M. C., Qi, L. S., Kampmann, M., & Weissman, J. S. (2014). Genome-Scale CRISPR-Mediated...References CRISPR ( C lustered R egularly I nterspaced S hort P alindromic R epeats) is a powerful system that...generally only compatible with smaller Cas enzymes, like S. aureus Cas9. For more information, see our blog post... -
Adeno-associated virus (AAV) Guide
TypeGuide..., C., Gorbatyuk, O. S., Velardo, M. J., Peden, C. S., Williams, P., Zolotukhin, S., Reier, P. J., Mandel...B. Y., Viswanathan, S., Gaj, T., Lavzin, M., Ritola, K. D., Lindo, S., Michael, S., Kuleshova, E., Ojala...tropism of AAV serotypes, indicating different serotype(s) for transduction of a given organ. Tissue Serotype...W. L., Sánchez-Guardado, L., Lois, C., Mazmanian, S. K., Deverman, B. E., & Gradinaru, V. (2017). Engineered...12871018 (Link opens in a new window) Hüser, D., Weger, S., & Heilbronn, R. (2003). Packaging of human chromosome... -
Chemogenetics Guide
TypeGuide... JC, Snowball A, Knauss S, von Schimmelmann M, During MJ, Lignani G, Schorge S, Young D, Kullmann DM, ...their activity in neurons PSAM Ion Pore Domain Ligand(s) Effect Outcome (in neurons) Reference PSAM4 Gly Varenicline... window) Armbruster BN, Li X, Pausch MH, Herlitze S, Roth BL (2007). Evolving the lock to fit the key ...Haberman A, Graham J, Block J, Zhou W, Chen Y, Zhang S-C (2021). Human Stem Cell-Derived Neurons Repair Circuits... -
Molecular Biology Reference
TypeGuide...plasmid. Additionally, the restriction enzyme site(s) allow for the cloning of a fragment of DNA to be ...information and a more extensive strain list. Strain Vendor(s) Genotype BL21 Invitrogen; New England BioLabs E. ...datasheet or the plasmid map to confirm which antibiotic(s) to add to your LB media or LB agar plates. Antibiotic..., or T K G or T M A or C N A, T, C, or G R A or G S C or G V A, C, or G W A or T Y C or T Amino Acids ..., UUC Proline Pro P CCU, CCC, CCA, CCG Serine Ser S UCU, UCC, UCA, UCG, AGU,AGC Threonine Thr T ACU, ACC...SV40 NLS PKKKRKV or PKKKRKVG Protein C EDQVDPRLIDGK S Tag KETAAAKFERQHMDS SB1 PRPSNKRLQQ Webpage and Blog... -
Science Guides
TypeGuide...CRISPR Class 2 C lustered R egularly I nterspaced S hort P alindromic R epeat (CRISPR) systems, which ... -
Antibody Guide
TypeGuide...slotted in a specific direction based on the emission(s) read by the machine. Controls for cell sorting methods...