Skip to main content
Addgene

We narrowed to 11 results for: %s

Showing: 1 - 11 of 11 results
  1. CRISPR Guide

    Type
    Guide
    ...23287722 Makarova, K. S., Wolf, Y. I., Alkhnbashi, O. S., Costa, F., Shah, S. A., Saunders, S. J., Barrangou,...Ishiguro, S., Gao, L., Hirano, S., Okazaki, S., Noda, T., Abudayyeh, O. O., Gootenberg, J. S., Mori, H...Chandrasekaran, S. S., Perry, N. T., Schaepe, J., Du, P. P., Lotfy, P., Bassik, M. C., Bintu, L., Bhatt, A. S., & ...PMID: 38216671 Klompe, S. E., Vo, P. L. H., Halpin-Healy, T. S., & Sternberg, S. H. (2019). Transposon-encoded...Scheiman, J., Vora, S., Pruitt, B. W., Tuttle, M., Iyer, E. P. R., Lin, S., Kiani, S., Guzman, C. D., Wiegand..., E. C., Newberry, K. M., Smith, S. B., Meadows, S. K., Roberts, B. S., Mackiewicz, M., Mendenhall, E....Gootenberg, J. S., Abudayyeh, O. O., Slaymaker, I. M., Makarova, K. S., Essletzbichler, P., Volz, S. E., Joung...
  2. Adenovirus Guide

    Type
    Guide
    ...Adenoviral Vector topics References Ahi, Y. S., Bangari, D. S., & Mittal, S. K. (2011). Adenoviral vector immunity...) Ewer, K. J., Sebastian, S., Spencer, A. J., Gilbert, S. C., Hill, A. V. S., & Lambe, T. (2017). Chimpanzee... new window) Lee, C. S., Bishop, E. S., Zhang, R., Yu, X., Farina, E. M., Yan, S., Zhao, C., Zheng, Z....J., Stanley, D., Honko, A., Johnson, J., Mulangu, S., Pau, M. G., Custers, J., Vellinga, J., Hendriks,...PMID: 21325402 (Link opens in a new window) Gilbert, S. C. (2015). Adenovirus-vectored Ebola vaccines . Expert...26289977 (Link opens in a new window) He, T. C., Zhou, S., da Costa, L. T., Yu, J., Kinzler, K. W., & Vogelstein... Li, Y., Zhang, W., Yang, C., Wu, K., Wu, Y., Ho, S., Athiviraham, A., Lee, M. J., Wolf, J. M., Reid, ...
  3. Gamma-Retroviral Vector Guide

    Type
    Guide
    ...Ravin, S. S., Su, L., Theobald, N., Choi, U., Macpherson, J. L., Poidinger, M., Symonds, G., Pond, S. M.,..., Abreu, S., Rubat, L., Nikoniuk, A., Macmorland, W., Horlock, C., Matsumoto, S., Williams, S., Smith,...Viral Protocols References Coffin, J. M., Hughes, S. H., & Varmus, H. E. (Eds.). (1997). Principles of...., Ferris, A. L., Hughes, S. H., Malech, H. L., & Wu, X. (2014). Enhancers are major targets for murine...., Wolfsberg, T. G., Baxevanis, A. D., & Burgess, S. M. (2014). MLV integration site selection is driven...Smith, K., Price, J., Srivastava, S., Hussain, R., Banani, M. A., Day, W., Stevenson, E., Madigan, M., Chen...doi.org/10.3390/v13081471 PMID: 34452336 Schnierle, B. S., Stitz, J., Bosch, V., Nocken, F., Merget-Millitzer...
  4. Lentiviral Vector Guide

    Type
    Guide
    ... Kim, H. S., Hwang, G., Lee, H. K., Bae, T., Park, S., Kim, Y. J., Lee, S., Park, J., Bae, S., & Hur, ..., J. N., Norberg, S. M., Hinrichs, C., Highfill, S. L., Somerville, R. P., Panch, S. R., Jin, P., & Stroncek...36348415 Stewart, S. A., Dykxhoorn, D. M., Palliser, D., Mizuno, H., Yu, E. Y., An, D. S., Sabatini, D. ...30518911 Wells, D. W., Guo, S., Shao, W., Bale, M. J., Coffin, J. M., Hughes, S. H., & Wu, X. (2020). An ...10.1128/jvi.72.11.8463-8471.1998 PMID: 9765382 Durand, S., & Cimarelli, A. (2011). The inside out of lentiviral...., Edavettal, J. M., Swaminathan, T. A., & Braun, S. E. (2021). HIV-based lentiviral vectors: Origin and...Hartenian, E., Shi, X., Scott, D. A., Mikkelsen, T. S., Heckl, D., Ebert, B. L., Root, D. E., Doench, J....
  5. Sequencing Primers

    Type
    Guide
    ...Invitrogen) S. cerevisiae GAL1 promoter, forward primer Gal10pro-F GGTGGTAATGCCATGTAATATG (Stratagene) S. cerevisiae... 5' GGGCTGGCAAGCCACGTTTGGTG 3' end of glutathione-S-transferase, forward primer SP6 ATTTAGGTGACACTATAG... reverse primer GPDpro-F CGGTAGGTATTGATTGTAATTCTG S. cerevisiae GPD promoter, forward primer GW-3' GCATGATGACCACCGATATG...promoter, forward primer Nmt1-F GCAATGTGCAGCGAAACTAA S. pombe nmt1 promoter, forward primer OpIE2 Forward... 5' GGGCTGGCAAGCCACGTTTGGTG 3' end of glutathione-S-transferase, forward primer pGP704-R AACAAGCCAGGGATGTAACG...
  6. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ..., C., Gorbatyuk, O. S., Velardo, M. J., Peden, C. S., Williams, P., Zolotukhin, S., Reier, P. J., Mandel...B. Y., Viswanathan, S., Gaj, T., Lavzin, M., Ritola, K. D., Lindo, S., Michael, S., Kuleshova, E., Ojala...of AAV serotypes, indicating the optimal serotype(s) for transduction of a given organ. Tissue Optimal...W. L., Sánchez-Guardado, L., Lois, C., Mazmanian, S. K., Deverman, B. E., & Gradinaru, V. (2017). Engineered...12871018 (Link opens in a new window) Hüser, D., Weger, S., & Heilbronn, R. (2003). Packaging of human chromosome...
  7. Plan Your Experiment

    Type
    Guide
    ...endogenous gene(s) without permanently modifying the genome dCas9-activator (such as dCas9-VP64) gRNA(s) targeting... (CRISPRi) Reduce expression of a particular gene(s) without permanently modifying the genome dCas9-repressor...repressor (such as dCas9-KRAB) or dCas9 gRNA(s) targeting promoter elements of target gene dCas9-KRAB ...
  8. Chemogenetics Guide

    Type
    Guide
    ... JC, Snowball A, Knauss S, von Schimmelmann M, During MJ, Lignani G, Schorge S, Young D, Kullmann DM, ...their activity in neurons PSAM Ion Pore Domain Ligand(s) Effect Outcome (in neurons) Reference PSAM4 Gly Varenicline... window) Armbruster BN, Li X, Pausch MH, Herlitze S, Roth BL (2007). Evolving the lock to fit the key ...Haberman A, Graham J, Block J, Zhou W, Chen Y, Zhang S-C (2021). Human Stem Cell-Derived Neurons Repair Circuits...
  9. Molecular Biology Reference

    Type
    Guide
    ...plasmid. Additionally, the restriction enzyme site(s) allow for the cloning of a fragment of DNA to be ...information and a more extensive strain list. Strain Vendor(s) Genotype BL21 Invitrogen; New England BioLabs E. ...datasheet or the plasmid map to confirm which antibiotic(s) to add to your LB media or LB agar plates. Antibiotic..., or T K G or T M A or C N A, T, C, or G R A or G S C or G V A, C, or G W A or T Y C or T Amino Acids ..., UUC Proline Pro P CCU, CCC, CCA, CCG Serine Ser S UCU, UCC, UCA, UCG, AGU,AGC Threonine Thr T ACU, ACC...SV40 NLS PKKKRKV or PKKKRKVG Protein C EDQVDPRLIDGK S Tag KETAAAKFERQHMDS SB1 PRPSNKRLQQ Webpage and Blog...
  10. Science Guides

    Type
    Guide
    ...CRISPR Class 2 C lustered R egularly I nterspaced S hort P alindromic R epeat (CRISPR) systems, which ...
  11. Antibody Guide

    Type
    Guide
    ...slotted in a specific direction based on the emission(s) read by the machine. Controls for cell sorting methods...
Showing: 1 - 11 of 11 results