We narrowed to 7,309 results for: aav
-
Plasmid#214490PurposeAiE2183m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1725 - pAAV-AiE2394m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214528PurposeAiE2394m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1762 - pAAV-AiE2344m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214538PurposeAiE2344m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1531 - pAAV-AiE2036m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214505PurposeAiE2036m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1426 - pAAV-AiE2133m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214496PurposeAiE2133m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1513 - pAAV-AiE2192m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214503PurposeAiE2192m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1668 - pAAV-AiE2347m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214513PurposeAiE2347m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1850 - pAAV-AiE2529m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214553PurposeAiE2529m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1432 - pAAV-AiE2144m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214498PurposeAiE2144m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1424 - pAAV-AiE2131m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214494PurposeAiE2131m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1882 - pAAV-AiE2464m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214568PurposeAiE2464m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1878 - pAAV-AiE2425m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214566PurposeAiE2425m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1690 - pAAV-AiE2365m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214517PurposeAiE2365m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1844 - pAAV-AiE2474m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214549PurposeAiE2474m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1642 - pAAV EF1a EGFP-KASH with mTACR1 gRNAs
Plasmid#195018PurposeAn adeno-associated viral vector expressing eGFP-KASH and two guides targeting mouse TACR1DepositorInsertsCCGTATAGGCGGCTGCCCAA
EGFP-KASH
TTCCGTGGTGGGCAACGTAG
UseAAVTagsKASH domain of Nesprin2PromoterEF1a, hU6, and mU6Available SinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1970 - pAAV-AiE2585m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214598PurposeAiE2585m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1895 - pAAV-AiE2583m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214574PurposeAiE2583m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1897 - pAAV-AiE2486m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214575PurposeAiE2486m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1916 - pAAV-AiE2437m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214577PurposeAiE2437m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1920 - pAAV-AiE2375m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214580PurposeAiE2375m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only