We narrowed to 16,426 results for: grna
-
Plasmid#62285Purposeexpression of scramble sgRNA from the arabinose-inducible promoterDepositorInsertscramble sgRNA
UseCRISPRExpressionBacterialPromoterpBADAvailable SinceApril 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
tRNA-gRNA position [n] (GB1207)
Plasmid#75408PurposetRNA and scaffold for the assembly of GBoligomers for the last position (positon [n]) of a polycistronic tRNA-gRNA (2- and 3-part multiplexing)DepositorInserttRNA-gRNA position [n]
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceAug. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9-Puro HLAG-2B-sgRNA
Plasmid#182552PurposeCas9 from S.pyogenes with 2A-Puro, and the 2B-sgRNA to targeting exon 2 of human HLA-G geneDepositorInserthSpCas9-2A-Puro-HLAG-2B-sgRNA
UseCRISPRExpressionMammalianPromoterCbhAvailable SinceMay 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-puro U6 sgRNA SOX17 -91
Plasmid#50923PurposeU6 driven sgRNA targeting Sox17 -91 bp from TSSDepositorAvailable SinceJan. 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
gRNAs[bTub+Sxl].1046B
Plasmid#112692Purposeexpress two gRNA targeting bTub & Sxl under dU6-3 promoterDepositorInsertU6.3-gRNA[bTub] and U6.3-gRNA[Sxl] (Sxl Fly)
UseCRISPRAvailable SinceJan. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
1183_pAAV-U6-Ex14-gRNAd-CB-EmGFP
Plasmid#89061PurposeAAV-gRNA targeting the murine Ldlr geneDepositorInsertEmGFP
UseAAV and CRISPRExpressionMammalianPromoterChicken beta actin with partial CMV enhancerAvailable SinceApril 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
px335-sgRNA-EF(Cas9wt)-Rif1
Plasmid#122306PurposeExpresses sgRNA targeting mouse Rif1 and Cas9 in mammalian cellsDepositorInsertsgRNA for mouse Rif1 (Rif1 Synthetic)
ExpressionMammalianAvailable SinceJune 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBbdCas9S(RBSmut)_Psyn-sgRNAmreB
Plasmid#149594Purposeall-in-one CRISPRi vector for targeting B. burgdorferi mreBDepositorInsertdCas9, lacI, sgRNAmreB
UseCRISPRExpressionBacterialPromoterPflaB, PpQE30, PsynAvailable SinceOct. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
px335-sgRNA-EF(Cas9n)-Eif4a1-R
Plasmid#122345PurposeExpresses sgRNA targeting mouse Eif4a1 and Cas9 nickase in mammalian cellsDepositorInsertsgRNA for mouse Eif4a1
ExpressionMammalianAvailable SinceJune 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHU6_chr12_FAM19A2-down-gRNA-rev
Plasmid#81222PurposepHu6-gRNA-NT1_SpecR backbone, gRNA for targeting the downstream region of FAM19A2 locusDepositorInserthU6 expression of gRNA
ExpressionMammalianPromoterU6Available SinceNov. 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
lenti-sgRNA(MS2)_zeo_hPDX1_promoter_guide1
Plasmid#176838PurposeTo induce human PDX1 expression by recruiting SAM complex to PDX1 promoterDepositorInsertsgPDX1
ExpressionMammalianPromoterU6Available SinceNov. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hPLK1)-PGKpuro2ABFP-W
Plasmid#163138PurposeLentiviral gRNA plasmid targeting human PLK1 gene, co-expression of BFP tagDepositorAvailable SinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
PasCas13b-gRNA-EGFP(W58stop)
Plasmid#180507PurposePasCas13b-gRNA targeting EGFP(W58stop) for RNA editingDepositorInsertPasCas13b-gRNA targeting EGFP(W58stop)
UseCRISPRExpressionMammalianPromoterU6Available SinceMarch 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
PasCas13b-gRNA-Nluc(W12stop)
Plasmid#180506PurposePasCas13b-gRNA targeting Nluc(W12stop) for RNA editingDepositorInsertPasCas13b-gRNA targeting Nluc(W12stop)
UseCRISPRExpressionMammalianPromoterU6Available SinceMarch 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKLV-gRNA-CTBP2-MGMT_1
Plasmid#136419PurposeLentiviral expression of gRNAs targeting intron 1 of human CTBP2 and intron 1 of human MGMT. Also constitutively expresses Puromycin fused to TagBFP.DepositorInsertU6_sgRNA(CTBP2)_U6_sgRNA(MGMT)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - Amplicon, JAK2 sgRNA 1
Plasmid#70679PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and an intergenic JAK2 amplicon-targeting sgRNA element from U6 promoter. Lentiviral backboneDepositorInsertsgRNA against JAK2 amplicon found in AML-derived HEL cell line (JAK2 )
UseCRISPR and LentiviralExpressionMammalianAvailable SinceOct. 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
PX459v2-ILK-gRNA 1-exon 1
Plasmid#163320PurposeSpCas9 ILK gRNA 1 (G*CGGAGAACGACCTCAACCAG), targeting exon 1 within the N-terminal ankyrin repeat domain-1.DepositorInsertILK gRNA 1_Exon1
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
PX459v2-ILK-gRNA 2-exon 8
Plasmid#163321PurposeSpCas9 ILK gRNA 2 (G*ACATTGTAGAGGGATCCATA), targeting exon 8 within the C-terminal protein kinase domain.DepositorInsertILK gRNA 2_Exon8
UseCRISPRExpressionMammalianPromoterU6FAvailable SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
p426-SNR52p-gRNA.clr-2.Y-SUP4t
Plasmid#89692PurposegRNA for clr-2 locusDepositorInsertgRNA for clr-2 locus
UseCRISPR; GrnaTagsNoAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
SauCas9KKH CCR5-nicking sgRNA
Plasmid#169863PurposeSauCas9KKH nicking sgRNA for CCR5DepositorInsertSauCas9KKH CCR5-nicking sgRNA
ExpressionMammalianPromoterhuman U6 promoterAvailable SinceJune 1, 2021AvailabilityAcademic Institutions and Nonprofits only