We narrowed to 31,856 results for: ica
-
Plasmid#226540PurposeBacterial expression of N-terminally 6His tagged A1-LCD V3DepositorInsertA1-LCD swap V3
Tags6xHisExpressionBacterialPromoterT7Available SinceNov. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDest17_A1-LCD swap X5
Plasmid#226547PurposeBacterial expression of N-terminally 6His tagged A1-LCD X5DepositorInsertA1-LCD swap X5
Tags6xHisExpressionBacterialPromoterT7Available SinceNov. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDest17_A1-LCD swap X7
Plasmid#226549PurposeBacterial expression of N-terminally 6His tagged A1-LCD X7DepositorInsertA1-LCD swap X7
Tags6xHisExpressionBacterialPromoterT7Available SinceNov. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDest17_A1-LCD swap X1
Plasmid#226543PurposeBacterial expression of N-terminally 6His tagged A1-LCD X1DepositorInsertA1-LCD swap X1
Tags6xHisExpressionBacterialPromoterT7Available SinceNov. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDest17_A1-LCD swap V5
Plasmid#226542PurposeBacterial expression of N-terminally 6His tagged A1-LCD V5DepositorInsertA1-LCD swap V5
Tags6xHisExpressionBacterialPromoterT7Available SinceNov. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDest17_A1-LCD swap X4
Plasmid#226546PurposeBacterial expression of N-terminally 6His tagged A1-LCD X4DepositorInsertA1-LCD swap X4
Tags6xHisExpressionBacterialPromoterT7Available SinceNov. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDest17_A1-LCD swapX3
Plasmid#226545PurposeBacterial expression of N-terminally 6His tagged A1-LCD X3DepositorInsertA1-LCD swap X3
Tags6xHisExpressionBacterialPromoterT7Available SinceNov. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDest17_A1-LCD swap V4
Plasmid#226541PurposeBacterial expression of N-terminally 6His tagged A1-LCD V4DepositorInsertA1-LCD swap V4
Tags6xHisExpressionBacterialPromoterT7Available SinceNov. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pETM6-T7-VHH-C9BoNT-A
Plasmid#202490PurposeExpresses the nanobody C9 BoNT/A with T7 inductionDepositorInsertnanobody C9 BoNT/A
Tags6XHisExpressionBacterialPromoterT7Available SinceNov. 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pETM6-Amp-T7-GFPuv
Plasmid#202463PurposeExpresses GFPuv with T7 inductionDepositorInsertGFPuv
ExpressionBacterialPromoterT7Available SinceNov. 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV-EGFP-nonstop
Plasmid#226406PurposeExpresses EGFP without a stop codon that produces a GFP-tagged readthrough RQC substrate.DepositorInsertEGFP without stop codon
ExpressionMammalianPromoterCMVAvailable SinceNov. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDest17_A1-LCD swap X10
Plasmid#226552PurposeBacterial expression of N-terminally 6His tagged A1-LCD X10DepositorInsertA1-LCD swap X10
Tags6xHisExpressionBacterialPromoterT7Available SinceNov. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDest17_A1-LCD swap X9
Plasmid#226551PurposeBacterial expression of N-terminally 6His tagged A1-LCD X9DepositorInsertA1-LCD swap X9
Tags6xHisExpressionBacterialPromoterT7Available SinceNov. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDest17_A1-LCD swap X8
Plasmid#226550PurposeBacterial expression of N-terminally 6His tagged A1-LCD X8DepositorInsertA1-LCD swap X8
Tags6xHisExpressionBacterialPromoterT7Available SinceNov. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDest17_A1-LCD swap X6
Plasmid#226548PurposeBacterial expression of N-terminally 6His tagged A1-LCD X6DepositorInsertA1-LCD swap X6
Tags6xHisExpressionBacterialPromoterT7Available SinceNov. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDest17_A1-LCD swap X2
Plasmid#226544PurposeBacterial expression of N-terminally 6His tagged A1-LCD X2DepositorInsertA1-LCD swap X2
Tags6xHisExpressionBacterialPromoterT7Available SinceNov. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRSII41K-TDH3pr-mNeon
Plasmid#194534PurposeLow copy vector backbone with G418 selectivity, encodes for TDH3(pr) driven expression of mNeonDepositorInsertkanMX
ExpressionYeastPromoterTDH3Available SinceOct. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRSII42K-TDH3pr-mNeon
Plasmid#194535PurposeHigh copy vector backbone with G418 selectivity, encodes for TDH3(pr) driven expression of mNeonDepositorInsertkanMX
ExpressionYeastPromoterTDH3Available SinceOct. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRSII41N-TDH3pr-mNeon
Plasmid#194536PurposeLow copy vector backbone with nourseothricin selectivity, encodes for TDH3(pr) driven expression of mNeonDepositorInsertnatAC
ExpressionYeastPromoterTDH3Available SinceOct. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRSII42N-TDH3pr-mNeon
Plasmid#194537PurposeHigh copy vector backbone with nourseothricin selectivity, encodes for TDH3(pr) driven expression of mNeonDepositorInsertnatAC
ExpressionYeastPromoterTDH3Available SinceOct. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRSII41H-TDH3pr-mNeon
Plasmid#194538PurposeLow copy vector backbone with hygromycin B selectivity, encodes for TDH3(pr) driven expression of mNeonDepositorInserthphMX
ExpressionYeastPromoterTDH3Available SinceOct. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS316-SEC18-L1374
Plasmid#226275PurposePlasmid expressing the SEC18 allele from L-1374, under control of its native promoterDepositorInsertSEC18 (SEC18 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS316-SEC18-S288C
Plasmid#226274PurposePlasmid expressing the SEC18 allele from S288C, under control of its native promoterDepositorInsertSEC18 (SEC18 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS316-SEC18-NCYC110
Plasmid#226277PurposePlasmid expressing the SEC18 allele from NCYC110, under control of its native promoterDepositorInsertSEC18 (SEC18 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS316-SEC18-UWOPS872421
Plasmid#226276PurposePlasmid expressing the SEC18 allele from UWOPS87-2421, under control of its native promoterDepositorInsertSEC18 (SEC18 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS313-SCT1-L1374
Plasmid#226267PurposePlasmid expressing the SCT1 allele from L-1374, under control of its native promoterDepositorInsertSCT1 (SCT1 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pML107-LUG1
Plasmid#226265PurposePlasmid expressing Cas9 and gRNA TCTTCAAGTTACTCCAAGAG which targets the LUG1 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-2
Plasmid#226263PurposePlasmid expressing Cas9 and gRNA GGTAGTGTTAGACCTGAACA which targets the LEU2 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS313-SCT1-NCYC110
Plasmid#226269PurposePlasmid expressing the SCT1 allele from NCYC110, under control of its native promoterDepositorInsertSCT1 (SCT1 Budding Yeast)
ExpressionYeastAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS313-SCT1-UWOPS872421
Plasmid#226268PurposePlasmid expressing the SCT1 allele from UWOPS87-2421, under control of its native promoterDepositorInsertSCT1 (SCT1 Budding Yeast)
ExpressionYeastAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJB67
Plasmid#226316PurposeE. coli and H. neapolitanus shuttle vector; integrates the gene of interest and a kanamycin resistance marker into a neutral site on the H. neapolitanus genome.DepositorInsertCsoS2 with K to A CsoS2 MR1-6
ExpressionBacterialMutationK261A, K320A, K380A, K436A, K495A, K546APromoterpTRCAvailable SinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJB68
Plasmid#226315PurposeE. coli and H. neapolitanus shuttle vector; integrates the gene of interest and a kanamycin resistance marker into a neutral site on the H. neapolitanus genome.DepositorInsertCsoS2 with Y to A CsoS2 MR1-7
ExpressionBacterialMutationY300A, Y359A, Y420A, Y475A, Y534A, Y585A, Y644APromoterpTRCAvailable SinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJB74
Plasmid#226314PurposeE. coli and H. neapolitanus shuttle vector; integrates the gene of interest and a kanamycin resistance marker into a neutral site on the H. neapolitanus genome.DepositorInsertCsoS2 with Y to A CsoS2 MR1-5
ExpressionBacterialMutationY300A, Y359A, Y420A, Y475A, Y534APromoterpTRCAvailable SinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJB73
Plasmid#226313PurposeE. coli and H. neapolitanus shuttle vector; integrates the gene of interest and a kanamycin resistance marker into a neutral site on the H. neapolitanus genome.DepositorInsertCsoS2 with Y to A CsoS2 MR1-3
ExpressionBacterialMutationY300A, Y359A, Y420APromoterpTRCAvailable SinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJB51
Plasmid#226308PurposeE. coli and H. neapolitanus shuttle vector; integrates the gene of interest and a kanamycin resistance marker into a neutral site on the H. neapolitanus genome.DepositorInsertCsoS2 with V(T/S)G to AAA CsoS2 MR1
ExpressionBacterialMutationVTG273-275AAA, VTG284-286AAA, VTG295-297AAAPromoterpTRCAvailable SinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJB48
Plasmid#226307PurposeE. coli and H. neapolitanus shuttle vector; integrates the gene of interest and a kanamycin resistance marker into a neutral site on the H. neapolitanus genome.DepositorInsertCsoS2 with C to S CsoS2 MR1-6
ExpressionBacterialMutationC292S, C310S, C351S, C369S, C467S, C485S, C526S, …PromoterpTRCAvailable SinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJB47
Plasmid#226306PurposeE. coli and H. neapolitanus shuttle vector; integrates the gene of interest and a kanamycin resistance marker into a neutral site on the H. neapolitanus genome.DepositorInsertCsoS2 with C to S CsoS2 MR1-5
ExpressionBacterialMutationC292S, C310S, C351S, C369S, C467S, C485S, C526S, …PromoterpTRCAvailable SinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJB46
Plasmid#226305PurposeE. coli and H. neapolitanus shuttle vector; integrates the gene of interest and a kanamycin resistance marker into a neutral site on the H. neapolitanus genome.DepositorInsertCsoS2 with C to S CsoS2 MR1-4
ExpressionBacterialMutationC292S, C310S, C351S, C369S, C467S, C485SPromoterpTRCAvailable SinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJB45
Plasmid#226304PurposeE. coli and H. neapolitanus shuttle vector; integrates the gene of interest and a kanamycin resistance marker into a neutral site on the H. neapolitanus genome.DepositorInsertCsoS2 with C to S CsoS2 MR1-2
ExpressionBacterialMutationC292S, C310S, C351S, C369SPromoterpTRCAvailable SinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAMC070n1a12
Plasmid#209746PurposeColA BBa_B0014 tetAp SD8 ScTrpRS rrnB1 proB SD8 Lum1PylRS BBaB10014RNAItrpA+ J23100 SD8 MmPylRS T3Te-T7Te DHFRDepositorInserttRNA operon - ScTrpRS - Lum1PylRS - MmPylRS
ExpressionBacterialAvailable SinceOct. 18, 2024AvailabilityAcademic Institutions and Nonprofits only