We narrowed to 19,229 results for: IRE;
-
Plasmid#186355PurposeEntry clone with ORF encoding plasma membrane-targeted EGFP-GPI fusion protein flanked by Gateway recombination sequencesDepositorInsertsignal peptide of human CD59, eGFP, aa 67-102 of human CD59 which contains the GPI attachment site (CD59 Synthetic, Human)
UseExpression of a fluorescent membrane markerTagsEGFPAvailable SinceSept. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
NGFR 210Y177
Plasmid#27487DepositorUseRetroviralTagsIRES and NGFRExpressionMammalianMutationTyrosine 177 mutated to Phenylalanine (Y177F)Available SinceMarch 18, 2011AvailabilityAcademic Institutions and Nonprofits only -
pIGF1_P2 Promoter-FLuc
Plasmid#154267PurposeFirefly luciferase reporter containing the downstream Human IGF-1 P2 Promoter.DepositorAvailable SinceMarch 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
ATX3-77Q-R388G
Plasmid#184251PurposeRecombinant protein expression and purification. Encodes ataxin-3 full length with 3 UIMs and 13Q in the Poly-Q track-R388G fused with His-Tag and TEV cleavage sequence (N-terminal)DepositorInsertataxin-3 full length with 3 UIMs and 77Q in the Poly-Q track and point mutation R388G (ATXN3 Synthetic, Human)
Tags6x His-Tag and TEV cleavage siteExpressionBacterialMutationC-terminal codon optimization for protein expres…PromoterT7 promoterAvailable SinceAug. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pB-TR-hCAII
Plasmid#232480PurposeTetracycline inducible PiggyBac vector expressing human CAII gene including flag-tag (DYKDDDDK) on the 3' endDepositorInsertHuman carbonic anhydrase II (CA2 Human)
UseTransposon systemTagsDYKDDDDK (FLAG-tag)ExpressionMammalianPromoterCMV-TetOAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHLsec hSOD1
Plasmid#232481Purposevector for transient transfection expressing human SOD1gene including flag-tag (DYKDDDDK) on the 3' endDepositorInsertHomo sapiens superoxide dismutase 1 (SOD1 Human)
TagsDYKDDDDK (FLAG-tag)ExpressionMammalianPromoterCAGAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V1-rCD20-BSD
Plasmid#209752PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 1) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V2-rCD20-BSD
Plasmid#209753PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 2) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V3-rCD20-BSD
Plasmid#209754PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 3) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
ATX3 13Q- I77K Q78K W87K
Plasmid#185908PurposeExpresses ataxin-3 full length with 3 UIMs and 13Q in the Poly-Q track-I77K, Q78K,W87K (N-terminal ) fused with His-Tag and TEV cleavage sequence (C-terminal).DepositorInsertataxin-3 full length with 3 UIMs and 13Q in the Poly-Q track and point mutations I77K, Q78K and W87K (ATXN3 Synthetic, Human)
Tags6x His-Tag and TEV cleavage siteExpressionBacterialMutationPoint mutations in Atx3 gene I77K Q78K and W87KAvailable SinceAug. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pIGF1_P1 Promoter-FLuc2P
Plasmid#154261PurposeDestabilized firefly luciferase reporter containing the canonical Human IGF-1 P1 Promoter.DepositorInsertIGF-1 canonical P1 Promoter (IGF1 Human)
ExpressionMammalianPromoterHuman IGF-1 P1 PromoterAvailable SinceMarch 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pIGF1_P2 Promoter-FLuc2P
Plasmid#154262PurposeDestabilized firefly luciferase reporter containing the downstream Human IGF-1 P2 Promoter.DepositorAvailable SinceMarch 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pB-CuR-hSOD1
Plasmid#232477PurposeThe inducible PiggyBac Cumate Switch vector (PBQM812A-1 System Biosciences) expressing human SOD1gene including flag -tag (DYKDDDDK) on the 3' endDepositorInsertHomo sapiens superoxide dismutase 1 (SOD1 Human)
UseTransposon systemTagsDYKDDDDK (FLAG-tag)ExpressionMammalianPromoterCMV-CuOAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
PIG-MycT58A
Plasmid#177648PurposeExpression of mouse Myc with T58A point mutationDepositorInsertMyc-T58A (Myc Mouse)
UseRetroviralTagsGFP and IRESExpressionMammalianMutationT58A point mutationAvailable SinceFeb. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pB-TR-hSOD1
Plasmid#232478PurposeTetracycline inducible PiggyBac vector expressing human SOD1gene including flag-tag (DYKDDDDK) on the 3' endDepositorInsertHomo sapiens superoxide dismutase 1 (SOD1 Human)
UseTransposon systemTagsDYKDDDDK (FLAG-tag)ExpressionMammalianPromoterCMV-TetOAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
MLRV3:HRE-P53-MAPK/JNK-FOXO-TGFβ
Plasmid#178320PurposeMultiplex luciferase reporter vector, with luciferase reporters for the pathways HRE, P53, AP-1, FOXO and SMAD.DepositorInsertsHRE RedFirefly reporter
P53 FLuc reporter
AP-1 Renilla reporter
FOXO NLuc Reporter
SMAD GrRenilla reporter
UseLuciferase and Synthetic BiologyExpressionMammalianAvailable SinceJuly 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
PIG-Myc
Plasmid#177650PurposeExpression of wild-type mouse MycDepositorAvailable SinceNov. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
Tol2-pA-GI-wt1bDNNterm-E1b-5xUAS-E1b-eGFP-GI-pA-Tol2; gcryst:CFP
Plasmid#135766PurposeThis plasmid can be used to express independently eGFP and a zebrafish wt1b dominant negative isoform (N-terminal domain) from a bidirectional 5xUAS. Also CFP expression under crystallin promoter.DepositorAvailable SinceJan. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-PCTK3
Plasmid#23710DepositorInsertPCTK3 (CDK18 Human)
UseGateway donor vectorAvailable SinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
pLV-puro-N-3HA-SREBP2-C-Flag
Plasmid#134287PurposeLentivector encoding 3XHA (N-term) and Flag (C-term)-tagged SREBP2DepositorInsertSREBP2 (Srebf2 Mouse)
UseLentiviralTags3x HA and FlagExpressionMammalianMutationmouse SREBP2 precursorPromoterCMVAvailable SinceMarch 20, 2020AvailabilityAcademic Institutions and Nonprofits only