We narrowed to 5,485 results for: crispr cas9 grna plasmid
-
Plasmid#131336PurposegRNA to delete control region near HoxD. Use with HoxD del control usDepositorInsertCTRL-gRNA-C-del
UseCRISPRExpressionMammalianAvailable SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
HoxD del us1
Plasmid#131337PurposegRNA to delete a nucleation site near HoxD. Use with HoxD del ds1DepositorInsertEVX2-gRNA-N-del
UseCRISPRExpressionMammalianAvailable SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
HoxD del control us
Plasmid#131335PurposegRNA to delete control region near HoxD. Use with HoxD del control dsDepositorInsertCTRL-gRNA-N-del
UseCRISPRExpressionMammalianAvailable SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
GESTALT_pX330-v1
Plasmid#103061Purposeplasmid px330 with guide targeting GESTALT v1 through V5 constructsDepositorInsertintegration of Cas9 with guide targeting GESTALT barcodes V1 to V5
UseLentiviralAvailable SinceNov. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G1
Plasmid#188963PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: atcggtcgcattgttttccactagg
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceSept. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G2
Plasmid#188964PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: gttagacgctgattacatggactagg
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceSept. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pROS13_IDH2 #7
Plasmid#166102PurposeThis plasmid express a sgRNA that targets the IDH2 gene. This allows Cas9 to make a double-strand break and facilitate integration of LOV2 at position IDH2-135 by homologous recombination.DepositorArticleAvailable SinceApril 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pROS13_IDH1 #4
Plasmid#166101PurposeThis plasmid express a sgRNA that targets the IDH1 gene. This allows Cas9 to make a double-strand break and facilitate integration of LOV2 at position IDH1-67 by homologous recombination.DepositorArticleAvailable SinceApril 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2S291A/S293A
Plasmid#115205PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PDHA2S291A/S293A into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2S291A/S293A (PDHA2 Human)
UseLentiviralMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G2-RacE
Plasmid#188966PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA and racE gene for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: gttagacgctgattacatggactagg
racE
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
LCV2_mClover3_LacZ
Plasmid#155103Purposelentiviral plasmid expressing mClover3, Cas9 and a gRNA targeting LacZDepositorInsertLacZ_sgRNA_2
UseCRISPR and LentiviralExpressionMammalianPromoterU6 promoterAvailable SinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
px459 VRER
Plasmid#101716PurposesgRNA/SpCas9 expression plasmid with Cas9 VRER mutations (NGCG PAM)DepositorInsertSpCas9 VRER
Tags3xFLAG-NLS and NLSExpressionMammalianMutationVRER (D1135V, G1218R, R1335E and T1337R)Available SinceOct. 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1180 U6-reci Gag-pol v2
Plasmid#201915PurposeCas9-EDV production plasmid. Expresses the Gag-pol (CAG promoter) and sgRNA (human U6 promoter. BsmBI cutsites for spacer insertion)DepositorInsertGag-pol
ExpressionMammalianPromoterCAGAvailable SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRS159
Plasmid#122378PurposeCRISPRi plasmid for use in Candida albicans. Contains dCas9-Mxi1 and NEUT5L integration site and the sgRNA cloning site (SNR52 promoter, PacI sites, sgRNA tail)DepositorTypeEmpty backboneUseCRISPRExpressionYeastAvailable SinceMay 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAbaMCi-BsaI_pJMP2776
Plasmid#208890PurposeAcinetobacter baumannii CRISPRi plasmid for cloning new guides (BsaI cloning site in gRNA cassette).DepositorInsertdCas9, sgRNA expression cassette
ExpressionBacterialAvailable SinceDec. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV.U6gLacZ.EFS-NS.H2B-RFP
Plasmid#170363PurposeNegative control plasmid used for Crispr/cas9 based disruption. Expressing nuclear RFP.DepositorInsertH2B-RFP
UseLentiviralPromoterEFS-NSAvailable SinceJune 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7WT-VA
Plasmid#115187PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7WT into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7WT (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7V51G-VA
Plasmid#115188PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7V51G into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7V51G (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7C53A-VA
Plasmid#115189PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7C53A into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7C53A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7H126A-VA
Plasmid#115190PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7H126A into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7H126A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only