We narrowed to 82,273 results for: TRI
-
Plasmid#87756PurposeBacterial expression vector for producing 6x histidine tagged rat DYRK1A kinase domain (residues 1-497)DepositorInsertGene coding for rat DYRK1A kinase domain (residues 1-497)
Tags6X histidine tagExpressionBacterialPromoterT7 RNA polymerase promoterAvailable SinceMay 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
1 pCOLI_A_NoTag
Plasmid#160143PurposeUntagged Amp resistant bacterial expression vectorDepositorTypeEmpty backboneTagsNoneExpressionBacterialPromoterT7Available SinceNov. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pKM1000
Plasmid#8840DepositorTypeEmpty backboneTagsT. maritima MBPExpressionBacterialAvailable SinceNov. 18, 2005AvailabilityAcademic Institutions and Nonprofits only -
pJF1106
Plasmid#8836DepositorTypeEmpty backboneTagsYersinia pestis MBPExpressionBacterialAvailable SinceDec. 16, 2005AvailabilityAcademic Institutions and Nonprofits only -
-
pKM1137
Plasmid#8841DepositorTypeEmpty backboneTagsV. cholera MBPExpressionBacterialAvailable SinceNov. 18, 2005AvailabilityAcademic Institutions and Nonprofits only -
EGFP Munc13-4
Plasmid#244996PurposeDistribution and localization of human wild-type Munc13-4 in cellsDepositorAvailable SinceOct. 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGWB602-cytUnaG
Plasmid#220101PurposeFor Agrobacterium-mediated transformation. Cytosol-localized mCherry-UnaG.DepositorInsertmCherry-UnaG
ExpressionPlantAvailable SinceOct. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
emiRFP 670 Rab3a Q81L
Plasmid#245018PurposeDistribution and localization of rat Rab3a Q81L mutantDepositorAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
mEmerald MADD
Plasmid#245051PurposeDistribution and localization of human wild-type MADD in cellsDepositorAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
EGFP Rab3a T36N
Plasmid#245014PurposeDistribution and localization of rat Rab3a T36N mutantDepositorAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
GS1.1/MYB60
Plasmid#140408PurposemApple expression regulated by the CaMV35S promoter, mCitrine expression regulated by the A. thaliana MYB60 promoter. nourseothricin acetyl transferase selectable marker (nat)DepositorInsertsmApple
mCitrine
UseSynthetic BiologyExpressionPlantPromoterA. thaliana MYB60 and Cauliflower mosaic virus 35SAvailable SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
GS1.1/CAB3
Plasmid#140410PurposemApple expression regulated by the CaMV35S promoter, mCitrine expression regulated by the A. thaliana CAB3 promoter. nourseothricin acetyl transferase selectable marker (nat)DepositorInsertsmApple
mCitrine
UseSynthetic BiologyExpressionPlantPromoterA. thaliana CAB3 and Cauliflower mosaic virus 35SAvailable SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
GS1.1/CURT1A
Plasmid#140411PurposemApple expression regulated by the CaMV35S promoter, mCitrine expression regulated by the A. thaliana CURT1A promoter. nourseothricin acetyl transferase selectable marker (nat)DepositorInsertsmApple
mCitrine
UseSynthetic BiologyExpressionPlantPromoterA. thaliana CURT1A and Cauliflower mosaic virus 3…Available SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
GS1.1/CURT1B
Plasmid#140412PurposemApple expression regulated by the CaMV35S promoter, mCitrine expression regulated by the A. thaliana CURT1B promoter. nourseothricin acetyl transferase selectable marker (nat)DepositorInsertsmApple
mCitrine
UseSynthetic BiologyExpressionPlantPromoterA. thaliana CURT1B and Cauliflower mosaic virus 3…Available SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
GS1.1/CURT1C
Plasmid#140413PurposemApple expression regulated by the CaMV35S promoter, mCitrine expression regulated by the A. thaliana CURT1C promoter. nourseothricin acetyl transferase selectable marker (nat)DepositorInsertsmApple
mCitrine
UseSynthetic BiologyExpressionPlantPromoterA. thaliana CURT1C and Cauliflower mosaic virus 3…Available SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
GS1.1/CURT1D
Plasmid#140414PurposemApple expression regulated by the CaMV35S promoter, mCitrine expression regulated by the A. thaliana CURT1D promoter. nourseothricin acetyl transferase selectable marker (nat)DepositorInsertsmApple
mCitrine
UseSynthetic BiologyExpressionPlantPromoterA. thaliana CURT1D and Cauliflower mosaic virus 3…Available SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
GS1.2/35S
Plasmid#140415PurposemApple expression regulated by the A. thaliana UBQ10 promoter, mCitrine expression regulated by the CaMV35S promoter. nourseothricin acetyl transferase selectable marker (nat)DepositorInsertsmApple
mCitrine
UseSynthetic BiologyExpressionPlantPromoterA. thaliana UBQ10 and Cauliflower mosaic virus 35…Available SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
GS1.2/PGC1
Plasmid#140416PurposemApple expression regulated by the A. thaliana UBQ10 promoter, mCitrine expression regulated by the A. thaliana PGC1 promoter. nourseothricin acetyl transferase selectable marker (nat)DepositorInsertsmApple
mCitrine
UseSynthetic BiologyExpressionPlantPromoterA. thaliana PGC1 and A. thaliana UBQ10Available SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
GS1.2/MYB60
Plasmid#140417PurposemApple expression regulated by the A. thaliana UBQ10 promoter, mCitrine expression regulated by the A. thaliana MYB60 promoter. nourseothricin acetyl transferase selectable marker (nat)DepositorInsertsmApple
mCitrine
UseSynthetic BiologyExpressionPlantPromoterA. thaliana MYB60 and A. thaliana UBQ10Available SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
GS1.2/CAB3
Plasmid#140419PurposemApple expression regulated by the A. thaliana UBQ10 promoter, mCitrine expression regulated by the A. thaliana CAB3 promoter. nourseothricin acetyl transferase selectable marker (nat)DepositorInsertsmApple
mCitrine
UseSynthetic BiologyExpressionPlantPromoterA. thaliana CAB3 and A. thaliana UBQ10Available SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
GS1.2/CURT1A
Plasmid#140420PurposemApple expression regulated by the A. thaliana UBQ10 promoter, mCitrine expression regulated by the A. thaliana CURT1A promoter. nourseothricin acetyl transferase selectable marker (nat)DepositorInsertsmApple
mCitrine
UseSynthetic BiologyExpressionPlantPromoterA. thaliana CURT1A and A. thaliana UBQ10Available SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
GS1.2/CURT1B
Plasmid#140421PurposemApple expression regulated by the A. thaliana UBQ10 promoter, mCitrine expression regulated by the A. thaliana CURT1B promoter. nourseothricin acetyl transferase selectable marker (nat)DepositorInsertsmApple
mCitrine
UseSynthetic BiologyExpressionPlantPromoterA. thaliana CURT1B and A. thaliana UBQ10Available SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
GS1.2/CURT1C
Plasmid#140422PurposemApple expression regulated by the A. thaliana UBQ10 promoter, mCitrine expression regulated by the A. thaliana CURT1C promoter. nourseothricin acetyl transferase selectable marker (nat)DepositorInsertsmApple
mCitrine
UseSynthetic BiologyExpressionPlantPromoterA. thaliana CURT1C and A. thaliana UBQ10Available SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
GS1.2/CURT1D
Plasmid#140423PurposemApple expression regulated by the A. thaliana UBQ10 promoter, mCitrine expression regulated by the A. thaliana CURT1D promoter. nourseothricin acetyl transferase selectable marker (nat)DepositorInsertsmApple
mCitrine
UseSynthetic BiologyExpressionPlantPromoterA. thaliana CURT1D and A. thaliana UBQ10Available SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
GS1.1/UBQ10
Plasmid#140406PurposemApple expression regulated by the CaMV35S promoter, mCitrine expression regulated by the A. thaliana UBQ10 promoter. nourseothricin acetyl transferase selectable marker (nat)DepositorInsertsmApple
mCitrine
UseSynthetic BiologyExpressionPlantPromoterA. thaliana UBQ10 and Cauliflower mosaic virus 35SAvailable SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
GS1.1/PGC1
Plasmid#140407PurposemApple expression regulated by the CaMV35S promoter, mCitrine expression regulated by the A. thaliana PGC1 promoter. nourseothricin acetyl transferase selectable marker (nat)DepositorInsertsmApple
mCitrine
UseSynthetic BiologyExpressionPlantPromoterA. thaliana PGC1 and Cauliflower mosaic virus 35SAvailable SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HygMx4-URA3-3
Plasmid#232886PurposePlasmid expressing Cas9 and gRNA GAAGTAACAAAGGAACCTAG which targets the URA3 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HygMx4-URA3-2
Plasmid#232885PurposePlasmid expressing Cas9 and gRNA TCGTACCACCAAGGAATTAC which targets the URA3 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
Lmir_cytGluRS_TP_pK7fWG2_IVD_FP611
Plasmid#228385PurposeExpresses N-term transit peptide from Lophophytum mirabile cytoplasmic Glutamate aminoacyl-tRNA synthetase (TRINITY_DN2194_c0_g1_i3); determination of L. mirabile cytoplasmic GluRS target localizationDepositorInsertN-terminal transit peptide from L. mirabile cytoplasmic GluRS (TRINITY_DN2194_c0_g1_i3)
TagsGreen Florescent ProtienExpressionPlantAvailable SinceFeb. 26, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits