We narrowed to 70,882 results for: LAS
-
Plasmid#232882PurposePlasmid expressing Cas9 and gRNA AAACCTTTTTACTCCACGCA which targets the HIS3 gene.DepositorInsertHIS3 gRNA (HIS3 Budding Yeast)
UseCRISPRTagsExpressionYeastMutationPromotersnR52Available sinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ZIM17
Plasmid#232901PurposePlasmid expressing Cas9 and gRNA AAATGTCTCACTTTGCAGTG which targets the ZIM17 gene.DepositorInsertZIM17 gRNA (ZIM17 Budding Yeast)
UseCRISPRTagsExpressionYeastMutationPromotersnR52Available sinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HIS3-2
Plasmid#232881PurposePlasmid expressing Cas9 and gRNA CCAAGTTCGACAACTGCGTA which targets the HIS3 gene.DepositorInsertHIS3 gRNA (HIS3 Budding Yeast)
UseCRISPRTagsExpressionYeastMutationPromotersnR52Available sinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ADE13
Plasmid#232887PurposePlasmid expressing Cas9 and gRNA GTAGCAGCAAAAGAAGACAA which targets the ADE13 gene.DepositorInsertADE13 gRNA (ADE13 Budding Yeast)
UseCRISPRTagsExpressionYeastMutationPromotersnR52Available sinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS313-rad53-5004
Plasmid#232902PurposePlasmid carrying the rad53-5004 allele with its native promoter and terminator.DepositorInsertRAD53 (RAD53 Budding Yeast)
UseTagsExpressionYeastMutationT600C, A680G, A1094T, C1615T, C2228APromoterAvailable sinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV-hSyn-PiGM-Iq(535/81, eGFP)
Plasmid#221612PurposeAAV encoding PiGM-Iq with minimal RGS10 domain, CRY2 (535 amino acid version), CIB1 (81 amino acid version).DepositorInsertPiGM-Iq (535/81,eGFP)
UseAAVTagsExpressionMutationRGS2 1-53 truncationPromoterHuman SynapsinAvailable sinceFeb. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLaG2-T7RNAPC
Plasmid#216337PurposeArabinose-inducible PBad promoter driving expression of the anti-eGFP nanobody LaG2 translationally fused to the C-terminal portion (residues 180-883) of T7RNAPDepositorInsertLaG2-T7RNAPC fusion
UseTagsExpressionBacterialMutationg2658a, g3915aPromoterAvailable sinceJan. 17, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
SJZ10
Plasmid#228270PurposePlasmid backboneDepositorTypeEmpty backboneUseTagsExpressionBacterialMutationPromoterAvailable sinceJan. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
SJZ9
Plasmid#228269PurposePlasmid backboneDepositorTypeEmpty backboneUseTagsExpressionBacterialMutationPromoterAvailable sinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
SJZ2
Plasmid#228264PurposePlasmid backboneDepositorTypeEmpty backboneUseTagsExpressionBacterialMutationPromoterAvailable sinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
SJZ4
Plasmid#228265PurposePlasmid backboneDepositorTypeEmpty backboneUseTagsExpressionBacterialMutationPromoterAvailable sinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
SJZ6
Plasmid#228267PurposePlasmid backboneDepositorTypeEmpty backboneUseTagsExpressionBacterialMutationPromoterAvailable sinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
SJZ1
Plasmid#228263PurposePlasmid backboneDepositorTypeEmpty backboneUseTagsExpressionBacterialMutationPromoterAvailable sinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
SJZ7
Plasmid#228268PurposePlasmid backboneDepositorTypeEmpty backboneUseTagsExpressionBacterialMutationPromoterAvailable sinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti puro HA-TUBA1B
Plasmid#227587PurposeLentiviral plasmid expressing human TUBA1B proteinDepositorInsertTUBA1B (TUBA1B Human)
UseLentiviralTagsHAExpressionMutationPromoterCMVAvailable sinceNov. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS415 GPDpro-RNQ1-CFP
Plasmid#224887PurposeLow copy plasmid for constitutive yeast expression of RNQ1 tagged with CFP using copper. This is construct can be used as an IPOD marker (Kaganovich et al., 2008).DepositorInsertRNQ1 (RNQ1 Budding Yeast)
UseTagsCFPExpressionYeastMutationPromoterGPDAvailable sinceOct. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET41-FeoB-OL4del
Plasmid#216744PurposeStudy the interaction of FeoB in P. aeruginosa, specifically focusing on the role of the outer loop 4 (OL4) by examining the variant lacking OL4 in its interaction with exogenous peptides.DepositorInsertfeoB (PA4358 P. aeruginosa (Bacteria))
UseTags8x HisExpressionBacterialMutationOuter loop 4 (OL4) with the sequence of [TLDGKPVQ…PromoterAvailable sinceMay 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
E3_pENTR_L3-L2_NI_G1333-DddA11-N
Plasmid#191609PurposeptpTALECD_v2mod vector assembly, Entry clone 1 with attL2 and L3DepositorInsertC- and N termini of platinum TALEN, a half of the evolved DddA (DddA11), and a uracil glycosylase inhibitor
UseOtherTagsExpressionMutationPromoterAvailable sinceFeb. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
E3_pENTR_L3-L2_NN_G1333-DddA11-N
Plasmid#191610PurposeptpTALECD_v2mod vector assembly, Entry clone 1 with attL2 and L3DepositorInsertC- and N termini of platinum TALEN, a half of the evolved DddA (DddA11), and a uracil glycosylase inhibitor
UseOtherTagsExpressionMutationPromoterAvailable sinceFeb. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
E1_pENTR_L1-L4_HD_G1333-DddA11-C
Plasmid#191599PurposeptpTALECD_v2mod vector assembly, Entry clone 1 with attL1 and L4DepositorInsertC- and N termini of platinum TALEN, a half of the evolved DddA (DddA11), and a uracil glycosylase inhibitor
UseOtherTagsExpressionMutationPromoterAvailable sinceFeb. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
E1_pENTR_L1-L4_NG_G1333-DddA11-C
Plasmid#191600PurposeptpTALECD_v2mod vector assembly, Entry clone 1 with attL1 and L4DepositorInsertC- and N termini of platinum TALEN, a half of the evolved DddA (DddA11), and a uracil glycosylase inhibitor
UseOtherTagsExpressionMutationPromoterAvailable sinceFeb. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
E1_pENTR_L1-L4_NI_G1333-DddA11-C
Plasmid#191601PurposeptpTALECD_v2mod vector assembly, Entry clone 1 with attL1 and L4DepositorInsertC- and N termini of platinum TALEN, a half of the evolved DddA (DddA11), and a uracil glycosylase inhibitor
UseOtherTagsExpressionMutationPromoterAvailable sinceFeb. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
E1_pENTR_L1-L4_NN_G1333-DddA11-C
Plasmid#191602PurposeptpTALECD_v2mod vector assembly, Entry clone 1 with attL1 and L4DepositorInsertC- and N termini of platinum TALEN, a half of the evolved DddA (DddA11), and a uracil glycosylase inhibitor
UseOtherTagsExpressionMutationPromoterAvailable sinceFeb. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
E3_pENTR_L3-L2_HD_G1333-DddA11-N
Plasmid#191607PurposeptpTALECD_v2mod vector assembly, Entry clone 1 with attL2 and L3DepositorInsertC- and N termini of platinum TALEN, a half of the evolved DddA (DddA11), and a uracil glycosylase inhibitor
UseOtherTagsExpressionMutationPromoterAvailable sinceFeb. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
E3_pENTR_L3-L2_NG_G1333-DddA11-N
Plasmid#191608PurposeptpTALECD_v2mod vector assembly, Entry clone 1 with attL2 and L3DepositorInsertC- and N termini of platinum TALEN, a half of the evolved DddA (DddA11), and a uracil glycosylase inhibitor
UseOtherTagsExpressionMutationPromoterAvailable sinceFeb. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCT03
Plasmid#212150PurposePlasmid expressing alanine dehydrogenase under inducible promoter PT7 control. The enzyme is thermophilic and works best at 50 C.DepositorInsertalanine dehydrogenase
UseTags6x HisExpressionBacterialMutationPromoterPT7Available sinceJan. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
SynCAM4/pCDNA3
Plasmid#197328PurposePlasmid expressing an antigen targeting NECL4/SynCAM4DepositorInsertSynCAM4 (Cadm4 Mouse)
UseTagsmycExpressionMammalianMutationPromoterAvailable sinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
-
pLV-SFFV-mCherry-WPRE-UbC-Emerald
Plasmid#211797PurposeLentiviral vector plasmid expressing mCherry under the spleen focus-forming virus (SFFV) promoter and Emerald under the Ubiquitin C (UbC) promoterDepositorInsertsmCherry
Emerald
UseLentiviralTagsExpressionMammalianMutationPromoterSFFV and UbCAvailable sinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
mBeta4/pCNA3.1
Plasmid#197316PurposePlasmid expressing an antigen used to generate an antibody that targets the BK beta4 potassium channel subunitDepositorInsertSlo B4 (Kcnmb4 Mouse)
UseTagsHAExpressionMammalianMutationPromoterAvailable sinceOct. 24, 2023AvailabilityAcademic Institutions and Nonprofits only