We narrowed to 13,996 results for: SHI
-
Plasmid#153961PurposeUsed to detect crossover-type DNA recombination events elicited by iso-positional nicking of two homologous DNA fragments (recombination analogous to Holliday's model)DepositorInsert5' and 3' EGFP fragments sharing a 386-bp sequence, separated by a NeoR gene cassette and arranged in the opposite direction
UseRetroviral; A reporter plasmid detecting dna reco…TagsNLS-ZFExpressionMammalianMutationNo mutationPromoterLTRAvailable SinceOct. 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
prCO
Plasmid#153960PurposeUsed to detect crossover-type DNA recombination events elicited by iso-positional nicking of two homologous DNA fragments (recombination analogous to Holliday's model)DepositorInsert5' and 3' EGFP fragments sharing a 386-bp sequence, separated by a NeoR gene cassette and arranged in the same direction
UseRetroviral; A reporter plasmid detecting dna reco…TagsNLS-ZFExpressionMammalianMutationNo mutationPromoterLTRAvailable SinceOct. 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
mei-S332-GFP 5.6kb genomic DNA in Casper4 T331D
Plasmid#112986PurposeP element vector for transposon insertion of mei-S332-GFP 5.6kb genomic DNA (T331D) into Drosophila genomeDepositorAvailable SinceAug. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
mei-S332-GFP 5.6kb genomic DNA in Casper4 T331A
Plasmid#112988PurposeP element vector for transposon insertion of mei-S332-GFP 5.6kb genomic DNA (T331A) into Drosophila genomeDepositorAvailable SinceAug. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
HLH Clock Pas 1-401 VenN L57E/L113E/W284A
Plasmid#47360PurposeClock fragment mutatation tagged with VenN used for BiFCDepositorInsertClock (Clock Mouse)
TagsVenus aa 1-155ExpressionMammalianMutationaa 1-401, L57E/L113E/W284APromoterCMVAvailable SinceJan. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
HLH Bmal Pas 1-465-VenC L95E
Plasmid#47365PurposeBmal fragment cloned with Venus tag used for mutationDepositorInsertBMAL (Bmal1 Mouse)
TagsVenus aa 156-239ExpressionMammalianMutationaa 1-465, L95EPromoterCMVAvailable SinceJan. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
HLH Bmal Pas 1-465-VenC L150E
Plasmid#47366PurposeBmal fragment cloned with Venus tag used for mutationDepositorInsertBMAL (Bmal1 Mouse)
TagsVenus aa 156-239ExpressionMammalianMutationaa 1-465, L150EPromoterCMVAvailable SinceJan. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
HLH Bmal Pas 1-465-VenC L95E/L150E/W427A
Plasmid#47372PurposeBmal fragment cloned with Venus tag used for mutationDepositorInsertBMAL (Bmal1 Mouse)
TagsVenus aa 156-239ExpressionMammalianMutationaa 1-465, L95E/L150E/W427APromoterCMVAvailable SinceJan. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
HLH Bmal Pas 1-465-VenC F423R
Plasmid#47368PurposeBmal fragment cloned with Venus tag used for mutationDepositorInsertBMAL (Bmal1 Mouse)
TagsVenus aa 156-239ExpressionMammalianMutationaa 1-465, F423RPromoterCMVAvailable SinceSept. 4, 2013AvailabilityAcademic Institutions and Nonprofits only -
HLH Bmal Pas 1-465-VenC W427A
Plasmid#47369PurposeBmal fragment cloned with Venus tag used for mutationDepositorInsertBMAL (Bmal1 Mouse)
TagsVenus aa 156-239ExpressionMammalianMutationaa 1-465, W427APromoterCMVAvailable SinceSept. 4, 2013AvailabilityAcademic Institutions and Nonprofits only -
HLH Bmal Pas 1-465-VenC V435R
Plasmid#47370PurposeBmal fragment cloned with Venus tag used for mutationDepositorInsertBMAL (Bmal1 Mouse)
TagsVenus aa 156-239ExpressionMammalianMutationaa 1-465, V435RPromoterCMVAvailable SinceSept. 4, 2013AvailabilityAcademic Institutions and Nonprofits only -
HLH Bmal Pas 1-465-VenC F423R/V435R
Plasmid#47371PurposeBmal fragment cloned with Venus tag used for mutationDepositorInsertBMAL (Bmal1 Mouse)
TagsVenus aa 156-239ExpressionMammalianMutationaa 1-465, F423R/V435RPromoterCMVAvailable SinceSept. 4, 2013AvailabilityAcademic Institutions and Nonprofits only -
-
gCH198 (crCD55-4_crB2M-1_crB2M-3_crCLTA-4_crFOLH1-1_crCD151-3_crHBG-3_crKIT-2_crKIT-3_crCD81-1)
Plasmid#217345PurposecrRNA array targeting CD55, B2M, CLTA, FOLH1, CD151, HBG1/HBG2, KIT, CD81DepositorInsertscrCD55-4 gRNA: actggtattgcggagccacgagg (CD55 Human)
crB2M-1 gRNA: atataagtggaggcgtcgcgctg (B2M Human)
crB2M-3 gRNA: aggaatgcccgccagcgcgacgc (B2M Human)
crCLTA-4 gRNA: ggctctgcaacaccgcctagacc (CLTA Human)
crFOLH1-1 gRNA: gctccagacctggggtccagttt (FOLH1 Human)
crCD151-3 gRNA: cgggaggccgcacccaccgcctg (CD151 Human)
crHBG-3 gRNA: ttcttcatccctagccagccgcc (HBG1, HBG2 Human)
crKIT-2 gRNA: tctgcgttctgctcctactgctt (KIT Human)
crKIT-3 gRNA: agctctcgcccaagtgcagcgag (KIT Human)
crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (CD81 Human)
UseCRISPR and LentiviralPromoterhU6Available SinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCE-mp53DD
Plasmid#41856PurposeNon-integrating (episomal) expression of mouse p53DD - p53 carboxy-terminal dominant-negative fragmentDepositorAvailable SinceJuly 18, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCE-hUL
Plasmid#41855PurposeNon-integrating (episomal) expression of human L-MYC and LIN28DepositorAvailable SinceMarch 25, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCXLE-mp53DD
Plasmid#41859PurposeNon-integrating (episomal) expression of mouse p53DD - p53 carboxy-terminal dominant-negative fragmentDepositorAvailable SinceJuly 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
pLox-LV-pCMV-FLPo-pGK-mCl-GP33/66
Plasmid#216482PurposeExpresses a lox-p flanked FLPo and mClover3 fluorescent protein with LMCV GP33-43 and GP66-77 epitopes embedded in loop of mclover for initiating and removing immunogenic tumor cells in KPFrt miceDepositorInsertsFLPo Recombinase
mClover3-GP33/66
UseLentiviralPromoterpCMV and pGKAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pNK2657
Plasmid#219741PurposeMoClo-compatible Level 0 promoterless vector encoding hispidin-synthase from Mycena citricolor codon-optimised for expression in Nicotiana benthamiana, Pichia pastoris, Homo sapiensDepositorInserthispidin- synthase from Mycena citricolor
UseSynthetic BiologyAvailable SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHR-BRD4ΔN-mCherry-sspB
Plasmid#121968PurposeExpresses fusion of disordered protein BRD4(462-1362), fluorescent protein mCherry, and sspB which upon light activation binds to iLID.DepositorInsertBRD4 (BRD4 Human)
UseLentiviralTagsmCherry-sspBExpressionMammalianMutationDeleted amino acids 1-461PromoterSFFVAvailable SinceApril 9, 2019AvailabilityAcademic Institutions and Nonprofits only