We narrowed to 18,326 results for: puro
-
Plasmid#176669PurposeExpression of sgRNA under C. quinquefasciatus U6 (CPIJ039596) promoter & delivery of D.mel-Actin5C::EBFP2-2A-puro|sgRNA cassette through PhiC31 RCME to AttP acceptor cell line/organismDepositorTypeEmpty backboneUseCrisprExpressionInsectAvailable SinceNov. 23, 2021AvailabilityAcademic Institutions and Nonprofits only
-
pSLQ1371-sgITGB1-3
Plasmid#121534PurposesgITGB1-3 sequence: GTTCAGTGAATGGGAACAACG. Lentiviral mouse U6 (mU6) promoter-driven expression vector that coexpessed Puro-T2A-mCherry from a CMV promoter.DepositorInsertsgITGB1-3
UseCRISPR and LentiviralTagsmCherryExpressionMammalianPromotermouse U6Available SinceNov. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1371-sgITGB4-1
Plasmid#121535PurposesgITGB4-1 sequence: GAGGCGCAGTCCTTATCCACA. Lentiviral mouse U6 (mU6) promoter-driven expression vector that coexpessed Puro-T2A-mCherry from a CMV promoter.DepositorInsertsgITGB4-1
UseCRISPR and LentiviralTagsmCherryExpressionMammalianPromotermouse U6Available SinceNov. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
LLP251 pEF1a-UNC5C-4-SunTag
Plasmid#100940PurposeTALE vector with UNC5C-4 insert fused to SunTagx10, driven by EF1a, with 3xHA tag, no PURO geneDepositorInsertTALE target sequence for UNC5C, SunTag array (10xGCN4)
UseTALENTags3xHAExpressionMammalianAvailable SinceJune 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
KL094 - pTRE3G-Flag-Halo-CTCF_WT-BGHpA-CAGGS-rtta3G-rbgpA-Frt-PGK-EM7-PuroR-bpA-Frt TIGRE donor
Plasmid#232930PurposeVector to introduce a constitutive rtta3G cassette and a DOX-inducible Flag-Halo-mCTCF WT, targeting the mouse TIGRE acceptor locus. Use with Addgene #92144 sgRNA. Use puromycin selection.DepositorInsertFlag-Halo-CTCF WT
UseMouse TargetingExpressionMammalianAvailable SinceMarch 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKG2440_pGEEC536_pShip-UbC-mRuby2-P2A-PuroR-bGH
Plasmid#239732PurposePlasmid expressing mRuby2 and PuroR with the UbC promoterDepositorInsertmRuby2-P2A-PuroR
UseSynthetic BiologyAvailable SinceJuly 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGL3-U6-sgRNA-BFP
Plasmid#107722PurposeFor expression of sgRNA from the U6 promoter with BFP expression simultaneouslyDepositorTypeEmpty backboneUseCRISPRAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pgRNA_hMECP2_promoter_No8
Plasmid#194902PurposeLentiviral construct with mCherry and Puro cassettes to express sgRNA-8 targeting the promoter of human MECP2.DepositorInsertsgRNA targeting human MECP2 promoter No.8
UseLentiviralExpressionMammalianPromoterU6Available SinceJan. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pgRNA_hMECP2_promoter_No6
Plasmid#194900PurposeLentiviral construct with mCherry and Puro cassettes to express sgRNA-6 targeting the promoter of human MECP2.DepositorInsertsgRNA targeting human MECP2 promoter No.6
UseLentiviralExpressionMammalianPromoterU6Available SinceJan. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pgRNA_hMECP2_promoter_No7
Plasmid#194901PurposeLentiviral construct with mCherry and Puro cassettes to express sgRNA-7 targeting the promoter of human MECP2.DepositorInsertsgRNA targeting human MECP2 promoter No.7
UseLentiviralExpressionMammalianPromoterU6Available SinceJan. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1371-sgYAP-10
Plasmid#121424PurposesgYAP-10 sequence: GTGCTGTCCCAGATGAACGTC. Lentiviral mouse U6 (mU6) promoter-driven expression vector that coexpessed Puro-T2A-mCherry from a CMV promoter.DepositorInsertsgYAP-10 (GTGCTGTCCCAGATGAACGTC)
UseCRISPR and LentiviralTagsmCherryExpressionMammalianPromotermouse U6Available SinceApril 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
CROP-seq-mTurquoise2-v2-no-scaffold
Plasmid#228522PurposeCROP-seq-puro-v2 with scaffold sequence removed for the insertion of CRISPRmap Opool with guide, scaffold and barcode sequences, using mTurquoise2 as selection markerDepositorInsertmTurquoise2
UseLentiviralAvailable SinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
px459-AMBRA1 #3
Plasmid#172606PurposeExpresses gRNA #3 against AMBRA1 and Cas9 from S. pyogenes with 2A-PuroDepositorAvailable SinceAug. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLentiX1-[TRE3G-TS.FF4x1-mRuby2-bGH]-EFS-rtTA-T2A-mGL-P2A-PuroR-WPRE
Plasmid#235316PurposeLentiviral expression of mRuby2 with 5' microRNA target site only (closed-loop)DepositorInsertmRuby2
UseLentiviral and Synthetic BiologyExpressionMammalianPromoterTRE3G (3rd-generation Tet system)Available SinceMay 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiX1-[TRE3G-TS.FF6x1-mRuby2-bGH]-EFS-rtTA-T2A-mGL-P2A-PuroR-WPRE
Plasmid#235315PurposeLentiviral expression of mRuby2 with 5' microRNA target site only (open-loop)DepositorInsertmRuby2
UseLentiviral and Synthetic BiologyExpressionMammalianPromoterTRE3G (3rd-generation Tet system)Available SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiX1-[TRE3G-mRuby2-TS.FF6x1-bGH]-EFS-rtTA-T2A-mGL-P2A-PuroR-WPRE
Plasmid#235313PurposeLentiviral expression of mRuby2 with 3' microRNA target site only (open-loop)DepositorInsertmRuby2
UseLentiviral and Synthetic BiologyExpressionMammalianPromoterTRE3G (3rd-generation Tet system)Available SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiX1-[TRE3G-mRuby2-miRE.FF4-bGH]-EFS-rtTA-T2A-mGL-P2A-PuroR-WPRE
Plasmid#235318PurposeLentiviral expression of mRuby2 with 3' microRNA onlyDepositorInsertmRuby2
UseLentiviral and Synthetic BiologyExpressionMammalianPromoterTRE3G (3rd-generation Tet system)Available SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiX1-[TRE3G-mRuby2-TS-FF4x1-bGH]-EFS-rtTA-T2A-mGL-P2A-PuroR-WPRE
Plasmid#235314PurposeLentiviral expression of mRuby2 with 3' microRNA target site only (closed-loop)DepositorInsertmRuby2
UseLentiviral and Synthetic BiologyExpressionMammalianPromoterTRE3G (3rd-generation Tet system)Available SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiX1-[TRE3G-mRuby2(miRE.FF4)-bGH]-EFS-rtTA-T2A-mGL-P2A-PuroR-WPRE
Plasmid#235317PurposeLentiviral expression of mRuby2 with intronic microRNA onlyDepositorInsertmRuby2
UseLentiviral and Synthetic BiologyExpressionMammalianPromoterTRE3G (3rd-generation Tet system)Available SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
sgOPTI:U6-gRNA-CS1-puroR
Plasmid#256351Purposelenti virus vector expressing a Cas9 guide RNA under a human U6 promoter. Contains capture sequence 1 (CS1) in the Cas9 scaffold. Contains puromycin resistance cassette.DepositorInsertsgRNA
UseLentiviralPromoterU6 promoterAvailable SinceJune 22, 2026AvailabilityAcademic Institutions and Nonprofits only