We narrowed to 8,451 results for: Ott
-
Plasmid#114414PurposeHomology arms and linker-mEGFP sequence for C-terminus tagging of human MYL2, via Cas9-excisable CAGGS-mCherry selection cassetteDepositorInsertMYL2 Homology Arms with linker-mEGFP and Cas9-excisable selection cassette (MYL2 Human)
UseCRISPR; Donor templateTagslinker-mEGFPExpressionMammalianMutationhomology arms contain point mutations to disrupt …PromoterAvailable sinceSept. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
Ad:2CMV_A2R2-N25Ctr
Plasmid#122243PurposeExpresses a dominant negative Kash control, that lacks the actual Kash domain for LINC complex integration, in addition to fluorescently tagged (mRuby2) α-Actinin-2 on an adenoviral backboneDepositorUseAdenoviralTagsSignal Peptide (TOR1A, NM_000113.2), mNeptune2.5,…ExpressionMammalianMutationdeleted Kash domain (GGCGAGGAGGAGCGCAGCTGCGCCCTGG…PromoterCMVAvailable sinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
CMV-SNAP-hCB2_IRES_EGFP
Plasmid#223506PurposeExpression of CB2 N-terminally fused SNAP-tag, with targeting sequence to boost plasma membrane expression. Coupled with EGFP transfection markerDepositorInsertSNAP-tag-CNR2 and EGFP (CNR2 Human, Synthetic)
UseTagsSNAP-tagExpressionMammalianMutationPromoterAvailable sinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(gGFP)-PGKmCherry2AGFP-W
Plasmid#67982PurposeCas9 activity reporter with mCherry and GFPDepositorInsertU6gRNA cassette, PGKmCherry2AGFP cassette, WPRE
UseCRISPR and LentiviralTagsExpressionMutationDeleted BbsI site within WPREPromoterAvailable sinceNov. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(gBFP)-PGKmCherry2ABFP-W
Plasmid#67986PurposeCas9 activity reporter with mCherry and BFPDepositorInsertsU6gRNA cassette, PGKmCherryABFP cassette, WPRE
Guide RNA targeting modified BFP
UseCRISPR and LentiviralTagsExpressionMutationDeleted BbsI site within WPRE, modified BFPPromoterAvailable sinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Flag::UbvG08 I44A, deltaGG
Plasmid#74939PurposeUbiquitin variant that binds to and occludes the ligand binding site of the 53BP1 Tudor domain (i53). Blocks 53BP1 from accumulating at sites of DNA damage. Potent selective inhibitor of 53BP1DepositorInsertUbiquitin
UseTagsFlagExpressionMammalianMutationUbvG08 with I44A mutation and no terminal GlycinesPromoterCMVAvailable sinceJune 30, 2016AvailabilityIndustry, Academic Institutions, and Nonprofits -
pKLV2-U6gRNA5(Empty)-PGKmCherry2ABFP-W
Plasmid#67985PurposeCas9 activity reporter (control) with mCherry and BFPDepositorInsertU6gRNA cassette, PGKmCherryABFP cassette, WPRE
UseCRISPR and LentiviralTagsExpressionMutationDeleted BbsI site within WPRE, modified BFPPromoterAvailable sinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pTBL235 NheI-Cas9-KpnI-GSAlinker-FseI-TdT-NotI
Plasmid#126480PurposeExpresses Cas9-GSAlinker-TdT in mammalian cells.DepositorInsertsUseTagsExpressionMammalianMutationChanged codons to reduce repetitive sequences.PromoterCMVAvailable sinceJune 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(BbsI)-PGKpuro2AZsG-W
Plasmid#67975PurposeCRISPR gRNA expression vector with an improved scaffold and puro/ZsG markersDepositorInsertU6gRNA cassette, PGKpuro2AZsG cassette, WPRE
UseLentiviralTagsExpressionMutationDeleted BbsI site within WPREPromoterhuman U6 promoter, mouse PGK promoterAvailable sinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.0-Magneto2.0-p2A-mCherry
Plasmid#74308PurposeBicistronic expression of Magneto2.0 and mCherry in mammalian cellsDepositorUseTagsFlag and p2A-mCherryExpressionMammalianMutationTRPV4: delta 760–871PromoterCMVAvailable sinceMay 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pKLV2.2-mU6gRNA5(SapI)-hU6gRNA5(BbsI)-PGKpuroBFP-W
Plasmid#72667PurposeLentiviral dual CRISPR gRNA expression vector (mouse U6 and human U6 promoters)DepositorInsertmU6gRNA cassette, hU6gRNA cassette, PGKpuroBFP cassette, WPRE
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceOct. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-EF1a-BsdCas9-W
Plasmid#67978PurposeLentiviral vector expressing Cas9 fused with the Blasticidin resistant gene at the N-terminusDepositorInsertEF1a-Cas9 cassette, WPRE
UseCRISPR and LentiviralTagsCas9 fused with Flag-tag and a NLS at the N termi…ExpressionMutationPromoterEF1aAvailable sinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCW-eGFP-SHLD1
Plasmid#114116PurposeLentiviral vector for inducible expression of N-terminally tagged eGFP-SHLD1DepositorInsertSHLD1 (SHLD1 Human)
UseLentiviral; Doxycycline inducibleTagseGFPExpressionMammalianMutationPromoterTRE promoter, Tet ONAvailable sinceAug. 28, 2018AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCMV-FLuc
Plasmid#170575PurposeExpress firefly luciferase. Used in MLV-based SARS-CoV-2 pseudovirus assay.DepositorInsertLuc
UseLuciferase and RetroviralTagsNAExpressionMammalianMutationPromoterCMVAvailable sinceMay 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pT2K-p53DN-T2A-copGFP
Plasmid#109229PurposeFor Tol2 transposon-mediated stable expression of dominant negative p53 and copGFPDepositorInsertdominant negative p53 (Trp53 Mouse)
UseTagscopGFPExpressionMammalianMutationdominant negative p53PromoterCAGGSAvailable sinceMay 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(BbsI)-PGKpuro2AmAG-W
Plasmid#67976PurposeCRISPR gRNA expression vector with an improved scaffold and puro/mAG markersDepositorInsertU6gRNA cassette, PGKpuro2AmAG cassette, WPRE
UseLentiviralTagsExpressionMutationDeleted BbsI site within WPREPromoterhuman U6 promoter, mouse PGK promoterAvailable sinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1 PA-PLA1 (EGFP-PA-PLA1)
Plasmid#162880PurposeExpression in mammalian cells of Phosphatidic Acid preferring Phospholipase A1 tagged with EGFPDepositorInsertPhosphatidic acid-preferring phospholipase A1 (PA-PLA1) (DDHD1 Human)
UseTagsEGFPExpressionMammalianMutationPromoterAvailable sinceJan. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-ABE8e-SpCas9-NRCH-P2A-EGFP (RMD57)
Plasmid#197504PurposeCMV and T7 promoter expression plasmid for human codon optimized ABE8e A-to-G base editor with nSpCas9-NRCH(D10A) and P2A-EGFPDepositorInsertpCMV-T7-ABE8e-NRCH-P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLS and BPNLS-P2A-EGFPExpressionMammalianMutationABE8e mutations in TadA and nSpCas9-NRCH(D10A/I32…PromoterCMV and T7Available sinceMarch 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pOPINB-HOIL-1 full-length (1–510)
Plasmid#193858PurposeExpression of human His-tagged HOIL-1 (RBCK1) full-length (1–510) codon optimized for E. coliDepositorInsertHOIL-1 (RBCK1 Human)
UseTags3C protease cleavage site and 6x-His tagExpressionBacterialMutationCodon optimised for expression in E. coliPromoterT7Available sinceJan. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET21a(+)-HIV RT-6xHis-RBS-prot
Plasmid#159149Purposeexpresses His-tagged HIV reverse transcriptase and untagged HIV proteaseDepositorInsertsHuman immunodeficiency virus 1 (HIV-1) reverse transcriptase
Human immunodeficiency virus 1 (HIV-1) protease
UseTagsHisExpressionBacterialMutationHIV-1 group M/subtype B – BH10 strainPromoterAvailable sinceSept. 1, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits