We narrowed to 18,090 results for: JUN
-
Plasmid#209690PurposeExpresses MAC-tagged VPS26C in mammalian cellsDepositorAvailable SinceAug. 6, 2024AvailabilityAcademic Institutions and Nonprofits only
-
pQA-LP572
Plasmid#222951PurposeExpresses E40A LoaPDepositorInsertantiterminator protein LoaP
Tags10xHIS-SUMOExpressionBacterialMutationmutated Glutamate 40 to AlaninePromoterT7Available SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
PGK EGFP-RAB3A-T86E
Plasmid#206148PurposePGK EGFP-RAB3A-T86EDepositorAvailable SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
PGK EGFP-RAB3A-T86A
Plasmid#206149PurposePGK EGFP-RAB3A-T86ADepositorAvailable SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET28a-ChmN-C47A
Plasmid#221367PurposeExpress C47A ChmN in E. coliDepositorInsertchmN-C47A
TagsHis6ExpressionBacterialMutationchanged Cys 47 to AlaAvailable SinceJuly 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pIVEX2.3-AC17-5c-frGFP
Plasmid#217525PurposeAC17-5c riboswitch-regulated GFP reporter. The gene is inserted into downstream of T7 promoter.DepositorInsertAC17-5c riboswitch-regulated folding reporter GFP
UseIn vitro transcription-translationPromoterT7Available SinceMay 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 N-terminal sgRNA
Plasmid#207094PurposepX330 based plasmid for expression of Cas9 and the TTACTGCAGAATGACTACAG sgRNA to target the SHLD3 locus.DepositorInsertTTACTGCAGAATGACTACAG
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
NBS1 C-terminal sgRNA
Plasmid#207092PurposepX330 based plasmid for expression of Cas9 and the TAAAAAGGAGAAGATAACTG sgRNA to target the NBS1 locus.DepositorInsertTAAAAAGGAGAAGATAACTG
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
RNF169 C-terminal sgRNA
Plasmid#207099PurposepX330 based plasmid for expression of Cas9 and the ACACTTCATTAGGTGCTACT sgRNA to target the RNF169 locus.DepositorInsertACACTTCATTAGGTGCTACT
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD1 N-terminal sgRNA
Plasmid#207101PurposepX330 based plasmid for expression of Cas9 and the ATGGCAGGACTATGGCAGCC sgRNA to target the SHLD1 locus.DepositorInsertATGGCAGGACTATGGCAGCC
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only