We narrowed to 19,057 results for: cat
-
-
gCH198 (crCD55-4_crB2M-1_crB2M-3_crCLTA-4_crFOLH1-1_crCD151-3_crHBG-3_crKIT-2_crKIT-3_crCD81-1)
Plasmid#217345PurposecrRNA array targeting CD55, B2M, CLTA, FOLH1, CD151, HBG1/HBG2, KIT, CD81DepositorInsertscrCD55-4 gRNA: actggtattgcggagccacgagg (CD55 Human)
crB2M-1 gRNA: atataagtggaggcgtcgcgctg (B2M Human)
crB2M-3 gRNA: aggaatgcccgccagcgcgacgc (B2M Human)
crCLTA-4 gRNA: ggctctgcaacaccgcctagacc (CLTA Human)
crFOLH1-1 gRNA: gctccagacctggggtccagttt (FOLH1 Human)
crCD151-3 gRNA: cgggaggccgcacccaccgcctg (CD151 Human)
crHBG-3 gRNA: ttcttcatccctagccagccgcc (HBG1, HBG2 Human)
crKIT-2 gRNA: tctgcgttctgctcctactgctt (KIT Human)
crKIT-3 gRNA: agctctcgcccaagtgcagcgag (KIT Human)
crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (CD81 Human)
UseCRISPR and LentiviralPromoterhU6Available SinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
sgLacZs
Plasmid#171185PurposeExpresses sgRNADepositorInserthU6-sgLacZ1-hU6-sgLacZ2
UseAAVTagsmCherryPromoterU6, hSynAvailable SinceAug. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pL0-MtPT4Pro
Plasmid#159414PurposeMedicago truncatula PT4 promoter sequence (836 bp immediately upstream of start codon) in pICH41295 MoClo Golden Gate level 0 acceptor for Pro+5U modules.DepositorInsertMtPT4 Promoter
UsePuc19-derivedExpressionBacterialAvailable SinceJuly 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
Plas-CRISPR_reporter
Plasmid#157658PurposeCRISPR reporter for mRNA quantification, integrative plasmid into NPR2 geneDepositorInsertdCAS9-VP64, mCherry, KanMX
UseInsert storage (replicative in e. coli)MutationN28D in mCherry- please see depositor comments be…Available SinceSept. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9_BB_2A-GFP_MAPRE3-gRNA#2
Plasmid#107730PurposeKnock out of EB3 in human cells by CRISPR/Cas9DepositorAvailable SinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
mTFP1-Vimentin-7
Plasmid#55515PurposeLocalization: Intermediate Filaments, Excitation: 462, Emission: 492DepositorAvailable SinceOct. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-syn-FLP-FRT-iGluSnFR4f-NGR-WPRE
Plasmid#234454PurposeAAV-mediated expression of glutamate sensor with improved sensitivity and fast deactivation kinetics (4f = fast); NGR vector matches or outperforms PDGFR in all conditions tested.DepositorInsertiGluSnFR4f-NGR
UseAAV; Flp/frtTagsIgK chain and Myc epi tag-NGR GPI anchorExpressionMammalianPromoterSynapsinAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
Flag-neo-PP1-Alpha-H248K
Plasmid#171268PurposeMammalian expression of 3x-Flag-tagged human PP1 alpha catalytic subunit H248K mutant that loses enzymatic activityDepositorInsert3x-Flag-tagged human PP1 alpha catalytic subunit H248K mutant (PPP1CA Human)
TagsFlagExpressionMammalianMutationPPP1CA-His248Lys (H248K)PromoterCMVAvailable SinceJune 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCOTS-pyl-GFP(35TAG)
Plasmid#92047PurposeThis is a S. elongatus (PCC7942) cyanobacterial plasmid that encodes the pylRS orthogonal translation system. In addition it encodes for a GFP reporter with TAG mutation at site 35.DepositorInsertsEGFP
Pyrrolysyl tRNA(cua)
Pyrrolysyl tRNA synthetase (methanosarcina mazei)
UseReplicative expression plasmid for cyanobacteria …TagsHistagMutationTyrosine in position 35 of the GFP was mutated f…PromoterLeuP (native S. elongatus promoter), PpsbII, and …Available SinceOct. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
hCD12
Plasmid#225541PurposeExpresses human histone deacetylase 6 (HDAC6) catalytic domain 1 and 2 (CD12), also known as hCD12, in Escherichia coli cells.DepositorInsertHuman Histone Deacetylase 6 Catalytic Domain 1 and 2 (HDAC6 Human)
TagsHis6-MBP tag with cleavable TEV siteExpressionBacterialPromoterT7Available SinceSept. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDF0430 huDisCas7-11-S1006-GGGS-D1221-U6-pro-Gluc
Plasmid#186987PurposeAAV transgene plasmid for Cas7-11-S1006-GGGS-D1221, with U6 promoter-driven expression of Gluc crRNA guideDepositorInsertcas7-11-s1006-gggs-d122, Gluc crRNA guide
UseAAVMutations1006-gggs-d1221 deletionAvailable SinceSept. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
CSK gRNA (BRDN0001144968)
Plasmid#77766Purpose3rd generation lentiviral gRNA plasmid targeting human CSKDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
mTFP1-Cx26-7
Plasmid#55473PurposeLocalization: Gap Junctions, Excitation: 462, Emission: 492DepositorInsertCx26
TagsmTFP1ExpressionMammalianPromoterCMVAvailable SinceOct. 10, 2014AvailabilityAcademic Institutions and Nonprofits only -
PGL3-U6-RNF2_pegRNA-Csy4RS-nick_sgRNA-EGFP
Plasmid#172669PurposeFor expression of transcript containing pegRNA and nick-sgRNA targeting human RNF2 gene from the U6 promoter with pegRNA flanked by Csy4 recognition siteDepositorInsertRNF2 pegRNA and RNF2_nick-sgRNA
ExpressionMammalianPromoterU6Available SinceAug. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR v2 RB1 sgRNA #1
Plasmid#202516PurposeExpressing Cas9 and sgRNA targeting human RB1 geneDepositorAvailable SinceJune 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
p1.2-GS
Plasmid#162770PurposeProtein expression in CHO cellsDepositorTypeEmpty backboneExpressionMammalianPromoterCHO EEF1A1 (Translation Elongation Factor 1 Alpha…Available SinceAug. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPFAS-2XStrep
Plasmid#125682Purposeexpresses human PFAS protein with a C-terminal 2XStrep affinity tagDepositorAvailable SinceMay 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCMV-cAICDA-BE3
Plasmid#113422PurposeExpresses cAICDA-BE3 in mammalian cellsDepositorInsertcAICDA-BE3 (aicda Ictalurus punctatus (channel catfish))
UseCRISPRExpressionMammalianPromoterCMVAvailable SinceAug. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCMV-Tag/M1 S245X
Plasmid#92366Purposeexpression of M1 S245X spastin in mammalian cellsDepositorInsertspastin (SPAST Human)
ExpressionMammalianMutation1-194 bp of 5'UTR deleted, S245XPromoterCMVAvailable SinceJune 12, 2017AvailabilityAcademic Institutions and Nonprofits only
