We narrowed to 13,228 results for: sequence
-
Plasmid#193626PurposeConstitutive T7 RNAP-mediated expression of LuxI 3OC6-HSL synthase for Lux quorum sensing system. LuxI sequence is codon optimized for E. coli.DepositorInsertLuxI
Tags6xHisExpressionBacterialPromoterT7 RNAP promoterAvailable SinceJuly 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pKT-iRFP-KAN
Plasmid#64687PurposepKT vector encoding yeast-codon optimized infrared fluorescent protein iRFP.DepositorInsertiRFP
ExpressionYeastMutationNucleotide sequence has been yeast-codon optimize…Available SinceMay 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMB1610_pRR-Puro
Plasmid#65853PurposePuromycin-based homologous recombination-dependent reporter for genome editing with TALENs or CRISPR/Cas9DepositorInsertsplit puromycin N-acetyltransferase coding sequence
UseCRISPR and TALENExpressionMammalianPromoterSV40Available SinceAug. 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
BTV
Plasmid#84771Purposebidirectional tetracycline-regulated viral reporter that measures the effects of 3' UTR sequences on mRNA and protein productionDepositorTypeEmpty backboneUseLentiviralExpressionMammalianAvailable SinceOct. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
AiRT_RTctrl
Plasmid#214070PurposeFluorescent reporter system, readthrough control, NMD negative control. Intron present in 5'UTRDepositorInsertTurboRFP
ExpressionMammalianMutationLinker sequence present between RFP and GFPAvailable SinceFeb. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-mRFP1-Human UTROPHIN_1-261
Plasmid#225052PurposeExpress in mammalian cells the mRFP1 fused to residues 1-261 of Human Utrophin to detect filamentous actin in live, fix cels or tissues.DepositorInsertHuman Utrophin residues 1-261 and RFP1 (UTRN Homo Sapiens, Human)
UseLentiviralTagsHuman UTROPHIN 1-261 and mRFP1ExpressionMammalianMutationSequence is derived from ADDGENE Plasmid #26739-R…PromoterCMV promoter and enhancerAvailable SinceSept. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-EGFP-Human-UTROPHIN_1-261
Plasmid#222393PurposeExpress in mammalian cells the EGFP fused to residues 1-261 of Human Utrophin to detect filamentous actin in live, fix cels or tissues.DepositorInsertHuman Utrophin residues 1-261 and EGFP (UTRN Homo Sapiens, Human)
UseLentiviralTagsEGFP and Human UTROPHIN 1-261ExpressionMammalianMutationSequence is derived from ADDGENE Plasmid #26737-G…PromoterCMV promoter and enhancerAvailable SinceSept. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMC-J6-dCas9-10XGP41-J9
Plasmid#202005PurposeMoClo level 0 dCas9-10XGP41 coding sequence moduleDepositorInsertdCas9-10XGP41
UseSynthetic Biology; Moclo cloning vectorTagsGS linkersAvailable SinceJuly 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSCB2-sgRNA
Plasmid#129463PurposeTemplate plasmid for guide sequence insertion via inverse PCR. Derived from pSCrhaB2-gRNA (see paper).DepositorInsertpgRNA
UseCRISPRExpressionBacterialPromoterBBa_J23119 (SpeI)Available SinceSept. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTR47m4
Plasmid#104068PurposeLuciferase Reporter for Formaldehyde SensingDepositorInsertsxluxAB
frmR
frm Promoter m4
UseLuciferase and Synthetic BiologyExpressionBacterialMutation23r and 25th nucleotides in sequence mutated from…Available SinceMarch 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv2-Stuffer-HepmCherry
Plasmid#192825PurposeContains stuffer sequence into which sgRNAs can be cloned and expresses mCherry from hepatocyte-specific promoterDepositorInsertmCherry
UseCRISPR and LentiviralExpressionMammalianPromoterHepatocyte-specific promoter (HS-CRM8-TTRmin modu…Available SinceNov. 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPLP1H-mCf
Plasmid#229984PurposeLIC vector for polycistronic expression of MS2 Phage-Like Particles in bacteria with packaged control sequence. His6 CP tag for IMAC purification.DepositorTypeEmpty backboneTagsHis6ExpressionBacterialPromoterT7Available SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPLP2H-mCf
Plasmid#229985PurposeLIC vector for improved polycistronic expression of MS2 Phage-Like Particles in bacteria with packaged control sequence. His6 CP tag for IMAC purification.DepositorTypeEmpty backboneTagsHis6ExpressionBacterialPromoterT7Available SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPLP3H-mCf
Plasmid#229987PurposeLIC vector for improved multigene expression of MS2 Phage-Like Particles in bacteria with packaged control sequence. His6 CP tag for IMAC purification.DepositorTypeEmpty backboneTagsHis6ExpressionBacterialPromoterT7Available SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSBLego
Plasmid#219967PurposeThe pSBLego vector enables sybodies for the Legobody method with a PelB signal for periplasmic expression and a "SLEHHHHHH" motif for purification and Legobody Fab binding.DepositorTypeEmpty backboneTagsSLEHHHHHH and pelB signal sequenceExpressionBacterialPromoterpBADAvailable SinceMarch 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
MDC1 KO sgRNA
Plasmid#207103PurposepX330 based plasmid for expression of Cas9 and the GGTGTAACGTGGAGCCAGTA sgRNA to target the MDC1 coding sequence.DepositorInsertGGTGTAACGTGGAGCCAGTA
ExpressionMammalianPromoterCMV and U6Available SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHACK(Gal4)-DONR(T2A-LexAGAD)
Plasmid#194769PurposeTo insert T2A-LexAGAD into Gal4 coding sequence in Drosophila, converting Gal4 into a T2A-LexAGAD transgene.DepositorInsertT2A-LexAGAD
UseCRISPRExpressionInsectAvailable SinceJan. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAd5-B6/7deltaE3
Plasmid#175748PurposeA block for the AdenoBuilder genome assembly system. The insert consolidates the regions present in pAd5-B6deltaE3 and pAd5-B7.DepositorInsertAdenovirus 5 genomic region 25043-35938
UseAdenoviral and Synthetic BiologyMutationAdenovirus sequences 27859-30803 replaced with Ba…Available SinceOct. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEXP5-NT/pT7 LuxR
Plasmid#193625PurposeConstitutive T7 RNAP-mediated expression of LuxR transcription factor for Lux quorum sensing system. LuxR sequence is codon optimized for E. coli.DepositorInsertLuxR
Tags6xHisExpressionBacterialPromoterT7 RNAP promoterAvailable SinceJuly 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
Cdk9-Halo donor
Plasmid#113113PurposeDonor plasmid for knock-in HaloTag fusing to the c-terminal of mouse Cdk9 coding sequenceDepositorInsertCdk9 donor region including homology arms and HaloTag
UseSynthetic BiologyAvailable SinceAug. 6, 2018AvailabilityAcademic Institutions and Nonprofits only