We narrowed to 9,760 results for: CAG
-
Plasmid#189799PurposeRetroviral delivery of control guide RNADepositorInsertLuciferase gRNA
UseRetroviralAvailable SinceOct. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMpGE010-sgRNA-Target1 (MpRTN1)
Plasmid#186295PurposeBinary vector for CRISPR/Cas9 (target 1: MpRTN1) in plants (for Agrobacterium-mediated genetic transformation)DepositorInsertsgRNA-Target1
UseCRISPRExpressionBacterialAvailable SinceSept. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
miniCMV-mCerulean-tDeg
Plasmid#185401PurposemCerulean-tDeg fluorogenic proteinDepositorInsertmCerulean-tDeg
ExpressionMammalianMutationWTPromoterminiCMV (GGTAGGCGTGTACGGTGGGAGGCCTATATAAGCAGAGCT)Available SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pB6-Hipp11-td-sfGFP-cre reporter-3pA stop-FNF-DTA
Plasmid#183026PurposeB6J Hipp11-FNF-pCAG-loxP-3xSV40pA-loxP-td-sfGFP-WPRE-bpA allele targeting vector, low copy numberDepositorInserttd-sfGFP
UseCre/Lox and Mouse TargetingExpressionBacterial and MammalianAvailable SinceApril 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pB6-Hipp11-tdTomato-cre reporter-3pA stop-FNF-DTA
Plasmid#183025PurposeB6J Hipp11-FNF-pCAG-loxP-3xSV40pA-loxP-tdTomato-WPRE-bpA allele targeting vector, low copy numberDepositorInserttdTomato
UseCre/Lox and Mouse TargetingExpressionBacterial and MammalianAvailable SinceApril 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEh_gRNA1
Plasmid#178758PurposeExpression of a gRNA that targets next to PAM library, used for E. haloalkaliphila type I-E systemDepositorInsertgRNA that targets next to PAM library, used for E. haloalkaliphila type I-E system
ExpressionBacterialAvailable SinceMarch 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMs_gRNA1
Plasmid#178764PurposeExpression of a gRNA that targets next to PAM library, used for Marinomonas sp. type I-E systemDepositorInsertgRNA that targets next to PAM library, used for Marinomonas sp. type I-E system
ExpressionBacterialAvailable SinceMarch 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLm_gRNA1
Plasmid#178752PurposeExpression of a gRNA that targets next to PAM library, used for L. mobilis type I-E systemDepositorInserta gRNA that targets next to PAM library, used for L. mobilis type I-E system
ExpressionBacterialAvailable SinceMarch 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc2_gRNA1
Plasmid#178740PurposeExpression of a gRNA that targets next to PAM library, used for A. chroococcum type I-E #2 systemDepositorInsertgRNA that targets next to PAM library, used for A. chroococcum type I-E #2 system
ExpressionBacterialAvailable SinceMarch 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEDJ8
Plasmid#177271PurposeDouble gRNA for RNH1 RNH201 knock-outDepositorInsertgRNA_RNH1_RNH201
ExpressionBacterial and YeastPromoterSNR52Available SinceDec. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
3919-32
Plasmid#176496PurposepCAG-puro-T2A-TetON3G-polyADepositorInsertpuroR-T2A-TetOn3G
ExpressionMammalianPromoterTREAvailable SinceNov. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
Ssh2 gRNA#3
Plasmid#163399PurposeCas9-mediated knockout of Ssh2 in mammalian cellsDepositorAvailable SinceAug. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
Ssh3 gRNA#1
Plasmid#163400PurposeCas9-mediated knockout of Ssh3 in mammalian cellsDepositorAvailable SinceAug. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
WIPI2d-TEVcs-TSF
Plasmid#171419PurposeFor the purifcation of WIPI2d proteinDepositorInsertWIPI2d (WIPI2 Human)
ExpressionMammalianAvailable SinceJuly 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
PHY55-mouse U6-sgLMNA
Plasmid#164045PurposeU6-driven sgRNA targeting LMNADepositorInsertLMNA targeting sgRNA
UseCRISPRPromotermouse U6Available SinceApril 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-sgSmg7
Plasmid#161809Purposeguide RNA for Smg7DepositorInsertsgRNA targeting mouse Smg7 (Smg7 Mouse, Synthetic)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJan. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBSV2_Psyn-sgRNAmreB
Plasmid#149634PurposemreB gRNA expression in B. burgdorferiDepositorInsertsgRNAmreB
UseCRISPRExpressionBacterialPromoterPsynAvailable SinceOct. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBSV2G_Psyn-sgRNAmreB
Plasmid#149566PurposemreB gRNA expression in B. burgdorferiDepositorInsertsgRNAmreB
UseCRISPRExpressionBacterialPromoterPsynAvailable SinceOct. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
OA-1050V (wingless)
Plasmid#132424Purposeexpress arrays of gRNA targeting Wingless under dU6-3 promoterDepositorInsertwingless gRNA array
ExpressionInsectPromoterU6-3Available SinceSept. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
PX330_ZNF503_2
Plasmid#135755PurposeEncodes gRNA for 3' target of human ZNF503DepositorAvailable SinceJan. 28, 2020AvailabilityAcademic Institutions and Nonprofits only