We narrowed to 9,829 results for: CAG
-
Plasmid#67499PurposeExpression of shRNA targeting human ARF5aDepositorAvailable sinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only
-
pAN-PBAD-sgRNA-A3T
Plasmid#62260Purposeexpression of A3T sgRNA from the arabinose-inducible promoterDepositorInsertA3T sgRNA
UseCRISPRExpressionBacterialPromoterpBADAvailable sinceApril 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAN-PBAD-sgRNA-A1T
Plasmid#62256Purposeexpression of A1T sgRNA from the arabinose-inducible promoterDepositorInsertA1T sgRNA
UseCRISPRExpressionBacterialPromoterpBADAvailable sinceApril 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAN-PBAD-sgRNA-A4NT
Plasmid#62261Purposeexpression of A4NT sgRNA from the arabinose-inducible promoterDepositorInsertA4NT sgRNA
UseCRISPRExpressionBacterialPromoterpBADAvailable sinceApril 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLenti_DualsgRNA_CTRL_Puro_T2A_BFP2
Plasmid#236730PurposeDual sgRNA targeting CTRL expressing BFP with Puromycin selectionDepositorInsertNegative CTRL
UseLentiviralAvailable sinceDec. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pU6_rd12_pegRNA_(PP7-C4-Q1)
Plasmid#232435PurposepegRNA with optimized 3' modifications to correct the rd12 mutationDepositorInsert3'-PP7-tagged pegRNA for rd12 correction driven by human U6 promoter
UseCRISPRPromoterU6Available sinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
TFORF2170
Plasmid#143348PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable sinceFeb. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
GEARBOCS-SPARCL1-N-HATag
Plasmid#218185PurposeTo tag Hevin with HA at the N-terminalDepositorInsertsgRNA (Sparcl1 Mouse)
UseAAV and CRISPRAvailable sinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
GEARBOCS-Vamp2-GeneTRAP
Plasmid#218187PurposeTo KO and genetrap mouse Vamp2 simultaneouslyDepositorInsertsgRNA (Vamp2 Mouse)
UseAAV and CRISPRAvailable sinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
GEARBOCS-SPARCL1-C-mCherryTag
Plasmid#218183PurposeTo tag Hevin with mCherry at its C-terminalDepositorInsertsgRNA (Sparcl1 Mouse)
UseAAV and CRISPRAvailable sinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
-
pJR152
Plasmid#196280PurposeCassette used in dual sgRNA library generationDepositorInserthU6-sgRNA-CR3
UseCRISPR and LentiviralPromoterhU6Available sinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
YN2_1_IL50_HOlocus
Plasmid#194426PurposeExpresses Cas9 and sgRNA cassettes for targeting the HO locus in yeast Saccharomyces cerevisiaeDepositorInsertCas9
ExpressionYeastMutationNAAvailable sinceMay 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgNotch2#2/Cre
Plasmid#193226PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Notch2 geneDepositorAvailable sinceDec. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
1161F
Plasmid#183138PurposePlasmid supports expression of 2 gRNAs targeting D.suzukii sxl, and 3 gRNA targeting D.suzukii bTub,Hr5Ie1-eGFP tagged, and can be integrated with pBac.DepositorInsertU6.3-gRNAs[sxl, bTub]
UseCRISPRExpressionInsectAvailable sinceOct. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-puro-hGSDMD
Plasmid#185377PurposeFor mammalian expression of guide RNA: CGCGCCAGACGCGCCACCCT that targets human GSDMD (Gasdermin D)DepositorAvailable sinceJune 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pOC1 Gria1-HA KI
Plasmid#183427PurposeCreON knock-in for GluA1-HA (amino acid position: stop codon)DepositorInsertgRNA and HA donor
UseCRISPRAvailable sinceApril 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEc-crRNA1
Plasmid#170088Purposeencodes E. coli type I-E single spacer arrayDepositorInsertE. coli type I-E single spacer array
UseCRISPR and Synthetic BiologyPromoterJ23119Available sinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPPC020.306
Plasmid#171148PurposeExpression of J3-BBa_J23117-mRFP and J306 scRNA on pBBR1-GmR plasmidDepositorInsertsJ306 scRNA
J3-BBa_J23117-mRFP
UseCRISPRExpressionBacterialPromoterBBa_J23119 and J3-BBa_J23117Available sinceOct. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
Tbx21 gRNA#2
Plasmid#170838PurposeCas9-mediated knockout of Tbx21 in mammalian cellsDepositorAvailable sinceAug. 25, 2021AvailabilityAcademic Institutions and Nonprofits only