We narrowed to 27,024 results for: Cat
-
Plasmid#232884PurposePlasmid expressing Cas9 and gRNA AGAATCGCATCTCTACACGG which targets the RER2 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pML104-LEU2-3
Plasmid#232894PurposePlasmid expressing Cas9 and gRNA GTTCTTAACTAGGATCATGG which targets the RER2 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-AVO1
Plasmid#232889PurposePlasmid expressing Cas9 and gRNA AATGATGACGACCATACCAG which targets the AVO1 gene.DepositorAvailable SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-INO80
Plasmid#232890PurposePlasmid expressing Cas9 and gRNA GGAAGTAGAATCATTCGTAG which targets the INO80 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSpec5'
Plasmid#228549PurposeTemplate for PCR amplification for gRNA cloning plasmid. The PCR product recombines in vivo with a PCR product from pSpec3', to clone gRNA plasmidDepositorInsertTruncated 5' region of aadA
UseCRISPRAvailable SinceDec. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSpec3'
Plasmid#228548PurposeTemplate for PCR amplification for gRNA cloning plasmid. The PCR product recombines in vivo with a PCR product from pSpec5', to clone gRNA plasmidDepositorInsertTruncated 3' region of aadA
UseCRISPRAvailable SinceDec. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
lentiGuideSLC35C1-neo
Plasmid#220868Purposeencodes CRISPR sgRNA targeting human SLC3C1DepositorInsertSLC35C1 (SLC35C1 Human)
UseLentiviralAvailable SinceSept. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pFastBac HTB His-TEV-rDPP9(S729A)-FLAG
Plasmid#217329PurposePurification of catalytically-dead rat DPP9 fusion with C-terminal FLAG tagfrom insect cellsDepositorInsertDPP9
TagsFLAG and His-TEVExpressionInsectMutationS729APromoterpolyhedrinAvailable SinceAug. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
KBB109
Plasmid#185066PurposeBacterial expression of C-terminus of NUP1 nucleoporin as GST-Nup1-C fusion truncated after NsiI restriction siteDepositorInsertNUP1
TagsGSTExpressionBacterialMutationNup1 C-terminal region, truncated at NsiI restric…Available SinceJuly 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRSAN-QUEEN BPKK
Plasmid#129381Purposemutant of QUEEN 84BPDepositorInsertQUEEN BPKK
ExpressionBacterialAvailable SinceOct. 15, 2021AvailabilityAcademic Institutions and Nonprofits only