We narrowed to 51,167 results for: ANG
-
Plasmid#185071PurposeSST::ACT2 "SA236"DepositorInsertACT2
ExpressionYeastMutationACT2-SA236Available SinceAug. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
KBB215
Plasmid#185068PurposeSST::WAK2 EcoRI/ScaI fragment (secretion confirmed)DepositorInsertWAK2
ExpressionYeastAvailable SinceAug. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
KBB438
Plasmid#185092PurposeGAL1::Rfa1[1-337, 344-621]-GFP with NLS removedDepositorInsertRFA1
ExpressionYeastMutationRfa1 with amino acids 338-343 deletedPromoterGAL1Available SinceJuly 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
KBB372
Plasmid#185084PurposeGAL::Rfa1[330-621]-GFP under control of GAL1 promoterDepositorInsertRFA1
TagsGFPExpressionYeastMutationRfa1 amino acids 330-621PromoterGAL1Available SinceJuly 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
-
pJH3410
Plasmid#179575PurposePunc-129(DB)::tomm20::miniSOG-SL2::RFP unc-54 3' UTR C.elegans B-MN -specific expression of miniSOG-SL2 RFPDepositorAvailable SinceMarch 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJH3458
Plasmid#179573PurposePttr-39::tomm20::miniSOG-SL2::BFP unc-54 3' UTR C.elegans D-MN -specific expression of miniSOG-SL2 BFPDepositorAvailable SinceMarch 1, 2022AvailabilityIndustry, Academic Institutions, and Nonprofits -
pJH2844
Plasmid#179541PurposePunc-25::tomm20::miniSOG-SL2::RFP unc-54 3' UTR C.elegans D-MN and other neurals expression of miniSOG-SL2 RFPDepositorAvailable SinceFeb. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJH2842
Plasmid#179540PurposePacr-5::tomm20::miniSOG-SL2::RFP unc-54 3' UTR C.elegans B-MN and other neurals expression of miniSOG-SL2 RFPDepositorAvailable SinceFeb. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJH2843
Plasmid#179389PurposePunc-4::tomm20::miniSOG-SL2::RFP unc-54 3' UTR C.elegans A-MN and other neurals expression of miniSOG-SL2 RFPDepositorAvailable SinceFeb. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBS-tRNA-Gly
Plasmid#174317PurposeFor in vitro transcription of mouse tRNAsDepositorInserttRNA-gly
ExpressionBacterialPromoterT7Available SinceNov. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-kcnj12a
Plasmid#173141PurposeThis gene was cloned into the gateway middle entry vector. It can be used for generating antisense riboprobe or gene expression using a gateway system.DepositorInsertkcnj12a (kcnj12a Zebrafish)
UsePcr cloning vectorPromoterNo promoter at 5 end; T7 promoter at 3 end.Available SinceSept. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pENTR-D-kcnj16
Plasmid#173146PurposeThis gene was cloned into the gateway middle entry vector. It can be used for generating antisense riboprobe or gene expression using a gateway system.DepositorInsertkcnj16a (kcnj16 Zebrafish)
UsePcr cloning vectorMutationStop codon removedPromoterNo promoter at 5 end; T7 promoter at 3 end.Available SinceSept. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-kcnj19b
Plasmid#173149PurposeThis gene was cloned into the gateway middle entry vector. It can be used for generating antisense riboprobe or gene expression using a gateway system.DepositorInsertkcnj19b (kcnj19b Zebrafish)
UsePcr cloning vectorPromoterNo promoter at 5 end; T7 promoter at 3 end.Available SinceSept. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pENTR-D-kcnj1a.1
Plasmid#173125PurposeThis gene was cloned into the gateway middle entry vector. It can be used for generating antisense riboprobe or gene expression using a gateway system.DepositorInsertkcnj1a (kcnj1a.1 Zebrafish)
UsePcr cloning vectorPromoterNo promoter at 5 end; T7 promoter at 3 end.Available SinceSept. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-kcnj11l
Plasmid#173140PurposeThis gene was cloned into the gateway middle entry vector. It can be used for generating antisense riboprobe or gene expression using a gateway system.DepositorInsertkcnj11l (kcnj11l Zebrafish)
UsePcr cloning vectorPromoterNo promoter at 5 end; T7 promoter at 3 end.Available SinceSept. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
UUUUA-pHG165c
Plasmid#170107PurposeConstitutively expressed, chimeric transcription activator comprising the AraC DNA binding domain and the UreR urea ligand binding domain.DepositorInsertUUUUA
ExpressionBacterialAvailable SinceAug. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
MMMMA-pHG165c
Plasmid#170108PurposeConstitutively expressed, chimeric transcription activator comprising the AraC DNA binding domain and the MelR L-melibiose ligand binding domain.DepositorInsertMelR
ExpressionBacterialAvailable SinceAug. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
XXXXA-pHG165c
Plasmid#170110PurposeConstitutively expressed, chimeric transcription activator comprising the AraC DNA binding domain and the XylS benzoate ligand binding domain.DepositorInsertXXXXA
ExpressionBacterialAvailable SinceAug. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
XXXXA_Q182A_R287H-pHG165c
Plasmid#170111PurposeConstitutively expressed , mutationally-enhanced chimeric transcription activator comprising the AraC DNA binding domain and the XylS benzoate ligand binding domain.DepositorInsertXXXXA_Q182A_R278H
ExpressionBacterialMutationQ182A, R287HAvailable SinceAug. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
RRRAA-pHG165c
Plasmid#170112PurposeConstitutively expressed, chimeric transcription activator comprising the AraC DNA binding domain and the RhaR rhamnose ligand binding domains.DepositorInsertRRRAA
ExpressionBacterialAvailable SinceAug. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMXs-Six1
Plasmid#158532PurposeExpresses mouse Six1 in mammalian cellsDepositorAvailable SinceJuly 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pENTR-D-TOPO-kcnt2a
Plasmid#164963PurposeZebrafish kcnt2a gene CDSDepositorInsertkcnt2a (kcnt2 Zebrafish)
UsePcr cloning vectorAvailable SinceMarch 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-P1-N-mCherry-C
Plasmid#159437PurposeCRISPR knock-in donor construct with fluorescent reporterDepositorInsertmCherry
UseCRISPRTags3' linker pair 1, 5' linker pair 1, C t…PromoterCMVAvailable SinceOct. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
IDA3::HA exon2 (WS13)
Plasmid#126874Purposep3xHA inserted within second exon of IDA3. Includes ampicilin and hygromycin resistance.DepositorInsertIDA3
UseOtherAvailable SinceAug. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
IDA3::NeonGreen N-term (WS14)
Plasmid#126875PurposeNeonGreen-tag attached to the N-terminus of IDA3. Includes ampicilin and hygromycin resistance.DepositorInsertIDA3
UseOtherTagsNeonGreenAvailable SinceAug. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
IDA3::NeonGreen exon2 (WS15)
Plasmid#126876PurposeNeonGreen-tag embedded in the second exon of IDA3. Includes ampicilin and hygromycin resistance.DepositorInsertIDA3
UseOtherAvailable SinceAug. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHis-Laforin
Plasmid#157989PurposeExpresses Laforin in E.coli cellDepositorAvailable SinceAug. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHCKan-yibDp-CBD-hGLY
Plasmid#134596PurposeLow Phosphate inducible hGLYAT2 with N-terminal chitin binding domain tagDepositorInserthuman glycine acyltransferase 2 (GLYATL2 )
Tagschitin binding domainExpressionBacterialPromoteryibDAvailable SinceMay 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1371-sgYAP-10
Plasmid#121424PurposesgYAP-10 sequence: GTGCTGTCCCAGATGAACGTC. Lentiviral mouse U6 (mU6) promoter-driven expression vector that coexpessed Puro-T2A-mCherry from a CMV promoter.DepositorInsertsgYAP-10 (GTGCTGTCCCAGATGAACGTC)
UseCRISPR and LentiviralTagsmCherryExpressionMammalianPromotermouse U6Available SinceApril 22, 2019AvailabilityAcademic Institutions and Nonprofits only