We narrowed to 9,938 results for: Pol
-
Plasmid#202550PurposeReady for cloning and heterologous expression of genes in mammalian cells with protein export to cultivation mediaDepositorTypeEmpty backboneTagsATG initiation codon followed by an IGKV3 signal …ExpressionMammalianPromoterCMVAvailable SinceAug. 25, 2023AvailabilityAcademic Institutions and Nonprofits only
-
pBactin-Nedd1-mOrange2
Plasmid#196860PurposeExpression of neural precursor cell expressed developmentally down-regulated 1 (Nedd1) fused to mOrange2DepositorInsertNedd1-mOrange2 (Nedd1 Rat)
ExpressionMammalianPromoterChicken bactin (plus Chicken bactin intron)Available SinceMay 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAG-rox-inv[Talpha1-iCre-pA]-rox-LynGFP
Plasmid#196874PurposeNeuron-specific expression of LynGFP reporter. Used in combination with Talpha1-Dre-pA plasmidsDepositorInsertLynGFP
UseCre/Lox; Dre/roxExpressionMammalianPromoterQuimeric CAGAvailable SinceMay 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAG-lox-inv[Talpha1-Dre-pA]-lox-Lyn-EGFP
Plasmid#196876PurposeNeuron-specific expression of LynGFP reporter. Used in combination with Talpha1-iCre-pA plasmidsDepositorInsertLynEGFP
UseCre/Lox; Dre/roxExpressionMammalianPromoterQuimeric CAGAvailable SinceMay 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBetaActin-FKBP-Halo-Dync1h1motor
Plasmid#191333PurposeExpresses the fluorescently labeled dynein motor domain fused to the dimerization domain FKBP to recruit it to the plasma membrane by using the chemical dimerization system FKBP-FRBDepositorInsertFKBP-Halo-Dync1h1motor (Dync1h1 Mouse)
ExpressionMammalianMutationDYNC1H1 motor domain aa 1453-4644Available SinceMarch 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBetaActin-FKBP-Dync1h1motor
Plasmid#191332PurposeExpresses the dynein motor domain fused to the dimerization domain FKBP to recruit it to the plasma membrane by using the chemical dimerization system FKBP-FRBDepositorInsertFKBP-Dync1h1motor (Dync1h1 Mouse)
ExpressionMammalianMutationDYNC1H1 motor domain aa 1453-4644Available SinceMarch 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAP14
Plasmid#186262PurposewgaA (a.k.a expA1) and wgaB (a.k.a expA23), bicistronic, under light light responsive PEL222 promoter and EL222 under constitutively active LacIq promoterDepositorInsertsExpressionBacterialPromoterLacIq (CGAATGGTGCAAAACCTTTCGCGGTATGGCATGATAGCGCCC…Available SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGEX-2T-TRR-C421-G2304D
Plasmid#182845Purposemutation G2304D (GGC/GAC), PCR product coding C-terminal residues 2011-2431 of TRR was inserted into modified pGEX-2T by Nde I-Nsi I sitesDepositorAvailable SinceApril 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGEX-2T-TRX-C751-E3616S
Plasmid#182844Purposemutation E3616S (GAA/TCA), PCR product coding C-terminal residues 2976-3726 of TRX was inserted into modified pGEX-2T by Nde I-Nsi I sites. Expression in E. coli. by IPTG inductionDepositorAvailable SinceApril 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGEX4T3-GST-NQO1(Y128F)
Plasmid#177141PurposeBacterial vector for expression of an N-terminal GST fusion of NQO1(Y128F) with a TEV protease site located between the GST tag and NQO1(Y128F)DepositorAvailable SinceDec. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti6.2-coHPDL H163A H258A 3xFLAG-V5
Plasmid#174131PurposeExpresses codon-optimized catalytically inactive HPDL with a 3xFlag-V5 tag in mammalian cellsDepositorInsert4-hydroxyphenylpyruvate dioxygenase like (HPDL Human)
UseLentiviralTags3xFLAG-V5ExpressionMammalianMutationCodon optimized, H163A, H258AAvailable SinceSept. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti6.2-coHPDL H258A 3xFlag-V5
Plasmid#174130PurposeExpresses codon-optimized catalytically inactive HPDL with a 3xFlag-V5 tag in mammalian cellsDepositorInsert4-hydroxyphenylpyruvate dioxygenase like (HPDL Human)
UseLentiviralTags3xFLAG-V5ExpressionMammalianMutationCodon optimized, H258AAvailable SinceSept. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET-DEST42-dre4
Plasmid#170440PurposeExpress drosophila dre4 in E.coli expression system. Generated from pDONR-dre4 by Gateway system. Used for custom antibody purification.DepositorInsertdre4 (dre4 Fly)
Tags6xHis and V5ExpressionBacterialMutationDeleted amino acids 1-20PromoterT7Available SinceJuly 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGEMHE-mClover3-bElys
Plasmid#171494PurposeT7 promotor drives in vitro transcription of mClover3-tagged bovine Elys mRNADepositorAvailable SinceJuly 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX030
Plasmid#167154PurposeMoClo-compatible Level 1 (position 5) vector encoding Neonothopanus nambi caffeoylpiruvate hydrolase nnCPH under control of 0.4 kb 35S promoter, for expression in plantsDepositorInsertp35s-nnCPH-ocsT
ExpressionPlantPromoterp35sAvailable SinceJune 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX022
Plasmid#167148PurposeMoClo-compatible Level 0-CDS2 promoterless vector encoding C-terminal half of the Neonothopanus nambi hispidin synthase nnHispS codon-optimised for expression in Nicotiana benthamianaDepositorInsertC-part of fungal hispidin synthase, nnHispS
UseSynthetic BiologyAvailable SinceJune 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX021
Plasmid#167147PurposeMoClo-compatible Level 0-SP promoterless vector encoding N-terminal half of the Neonothopanus nambi hispidin synthase nnHispS codon-optimised for expression in Nicotiana benthamianaDepositorInsertN-part of fungal hispidin synthase, nnHispS
UseSynthetic BiologyAvailable SinceJune 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
CPH3400 (YCp LEU2 Rpb1 A1529_G1534delInsLEVLFQGP)
Plasmid#91806PurposeYeast expression of S. cerevisiae Rpb1 with an internal PreScission protease siteDepositorInsertRPO21 (RPO21 Budding Yeast)
ExpressionYeastMutationResidues A1529-G1534 replaced with a PreScission …PromoterEndogenous Rpb1 promoterAvailable SinceMarch 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
CPH3477 (YCp LEU2 Rpb1 P1455_E1456InsLEVLFQGP)
Plasmid#91807PurposeYeast expression of S. cerevisiae Rpb1 with an internal PreScission protease siteDepositorInsertRPO21 (RPO21 Budding Yeast)
ExpressionYeastMutationPreScission Protease site (LEVLFQGP) inserted bet…PromoterEndogenous Rpb1 promoterAvailable SinceMarch 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
CPH3506 (pET151_Spt6 1247-1451 K1355A,K1435A)
Plasmid#91818PurposeBacterial expression of residues 1247-1451 from S. cerevisiae Spt6 with K1435A and K1355A mutationsDepositorInsertSPT6 (SPT6 Budding Yeast)
Tags6xHisExpressionBacterialMutationchanged lysine 1355 and lysine 1435 to alanines; …PromoterT7Available SinceMarch 11, 2021AvailabilityAcademic Institutions and Nonprofits only