We narrowed to 120,141 results for: MPI
-
Plasmid#232884PurposePlasmid expressing Cas9 and gRNA AGAATCGCATCTCTACACGG which targets the RER2 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pML104-LEU2-3
Plasmid#232894PurposePlasmid expressing Cas9 and gRNA GTTCTTAACTAGGATCATGG which targets the RER2 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS313_MSN5-LY00018
Plasmid#232903PurposePlasmid carrying MSN5 from LY00018 (YJM975) with its native promoter and terminator.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-AVO1
Plasmid#232889PurposePlasmid expressing Cas9 and gRNA AATGATGACGACCATACCAG which targets the AVO1 gene.DepositorAvailable SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-YFR054C
Plasmid#232900PurposePlasmid expressing Cas9 and gRNA GCTCAAAGAAACAATTAGAG which targets the YFR054C gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-SRP14
Plasmid#232896PurposePlasmid expressing Cas9 and gRNA GAAAACAAAATGCTCAACAG which targets the SRP14 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-TLG1
Plasmid#232897PurposePlasmid expressing Cas9 and gRNA GATGAAAACGAAGACGTGAG which targets the TLG1 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-VHT1
Plasmid#232898PurposePlasmid expressing Cas9 and gRNA TGCGGCCACACTGAAATACG which targets the VHT1 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-2
Plasmid#232883PurposePlasmid expressing Cas9 and gRNA GGTAGTGTTAGACCTGAACA which targets the LEU2 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-INO80
Plasmid#232890PurposePlasmid expressing Cas9 and gRNA GGAAGTAGAATCATTCGTAG which targets the INO80 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
1203AE-CMV-Cas7.1-7.2-H43A-mutant
Plasmid#221449PurposeEffector expresses Cas7.1, Linker1, Cas11, Linker 2, and deactivated Cas7.2 domains from DiCas7-11, H to A mutation at amino acid 43 in Cas7.1DepositorInsertTruncated DiCas7-11
UseCRISPRExpressionMammalianAvailable SinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
1203AF-CMV-Cas7.1-7.2-Y55A-mutant
Plasmid#221450PurposeEffector expresses Cas7.1, Linker1, Cas11, Linker 2, and deactivated Cas7.2 domains from DiCas7-11, Y to A mutation at amino acid 55 in Cas7.1DepositorInsertTruncated DiCas7-11
UseCRISPRExpressionMammalianAvailable SinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
1203AG-CMV-Cas7.1-7.2-N152A-mutant
Plasmid#221451PurposeEffector expresses Cas7.1, Linker1, Cas11, Linker 2, and deactivated Cas7.2 domains from DiCas7-11, N to A mutation at amino acid 152 in Cas7.1DepositorInsertTruncated DiCas7-11
UseCRISPRExpressionMammalianAvailable SinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV-hSyn-PiGM-Iq(535/81, eGFP)
Plasmid#221612PurposeAAV encoding PiGM-Iq with minimal RGS10 domain, CRY2 (535 amino acid version), CIB1 (81 amino acid version).DepositorInsertPiGM-Iq (535/81,eGFP)
UseAAVMutationRGS2 1-53 truncationPromoterHuman SynapsinAvailable SinceFeb. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGL3_THADA_alltoneg0
Plasmid#232372PurposeTHADA enhancer, all sensitizing elements made into buffering CoordinatorDepositorInsertTHADA (THADA Human)
UseLuciferaseMutationTHADA enhancer, all sensitizing elements made int…Available SinceFeb. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
-
pPMS-2016
Plasmid#232290PurposeProtein ExpressionDepositorAvailable SinceFeb. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGEX-N-TEV-Twin-Strep
Plasmid#222014PurposeExpress C-terminal Tobacco Etch Virus (TEV) protease cleavable Twin-Strep-tagged protein (ENLYFQGS-WSHPQFEK-(GGGS)2-GGSA-WSHPQFEK) in E.coliDepositorTypeEmpty backboneTagsTEV cleavable site (ENLYFQG) and Twin-strep-tagExpressionBacterialPromoterlac promoterAvailable SinceJan. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSpec5'
Plasmid#228549PurposeTemplate for PCR amplification for gRNA cloning plasmid. The PCR product recombines in vivo with a PCR product from pSpec3', to clone gRNA plasmidDepositorInsertTruncated 5' region of aadA
UseCRISPRAvailable SinceDec. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSpec3'
Plasmid#228548PurposeTemplate for PCR amplification for gRNA cloning plasmid. The PCR product recombines in vivo with a PCR product from pSpec5', to clone gRNA plasmidDepositorInsertTruncated 3' region of aadA
UseCRISPRAvailable SinceDec. 2, 2024AvailabilityAcademic Institutions and Nonprofits only