We narrowed to 16,006 results for: grna
-
Plasmid#110922Purposeexpression of nat gene conferring resistance to nourseothricin for gene deletion in yeastDepositorInsertnat
ExpressionBacterial and YeastPromoterAgTEF1Available sinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pPN432
Plasmid#137870PurposeExpression of gRNA a3 targeting TCF4 for CRISPRa; U6 promoterDepositorAvailable sinceFeb. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPN431
Plasmid#137869PurposeExpression of gRNA a2 targeting TCF4 for CRISPRa; U6 promoterDepositorAvailable sinceFeb. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPN435
Plasmid#137867PurposeExpression of gRNA i3 targeting TCF4 for CRISPRi; U6 promoterDepositorAvailable sinceFeb. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPN434
Plasmid#137866PurposeExpression of gRNA i2 targeting TCF4 for CRISPRi; U6 promoterDepositorAvailable sinceFeb. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPN459
Plasmid#137875PurposePiggyBac vector for expression of 1x gRNA targeting TCF4 for CRISPRi; mRFP-T2A-BlasticidinRDepositorAvailable sinceFeb. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPN446
Plasmid#137868PurposeExpression of gRNA a1 targeting TCF4 for CRISPRa; U6 promoterDepositorAvailable sinceFeb. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPN454
Plasmid#137865PurposeExpression of gRNA i1 targeting TCF4 for CRISPRi; U6 promoterDepositorAvailable sinceFeb. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAT3156-(PB3-Puro-EGFP_7xU6-sgRNA-5xPBSa [MED1-Rank1_COLO320 DM_ AT_sg-276-282])
Plasmid#251113PurposeExpression multiple sgRNAsDepositorInsertsgRNAs
ExpressionMammalianMutationN/AAvailable sinceApril 27, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAT3158-{PB3-Puro-EGFP_7xU6-sgRNA-5xPBSa [MED1-Rank3_COLO320 DM_ AT_sg-290-296])
Plasmid#251115PurposeExpression multiple sgRNAsDepositorInsertsgRNAs
ExpressionMammalianMutationN/AAvailable sinceMarch 24, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAT3159-(PB3-Puro-EGFP_7xU6-sgRNA-5xPBSa [MED1-Rank4_COLO320 DM_ AT_sg-297-303])
Plasmid#251116PurposeExpression multiple sgRNAsDepositorInsertsgRNAs
ExpressionMammalianMutationN/AAvailable sinceFeb. 10, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAT3157-{PB3-Puro-EGFP_7xU6-sgRNA-5xPBSa [MED1-Rank2_COLO320 DM_ AT_sg-283-289])
Plasmid#251114PurposeExpression multiple sgRNAsDepositorInsertsgRNAs
ExpressionMammalianMutationN/AAvailable sinceFeb. 10, 2026AvailabilityAcademic Institutions and Nonprofits only -
pX330-COSMC-KO
Plasmid#80008PurposegRNA to knock out expression of COSMC (C1GalT1C1) gene. The product of this gene is a chaperone aiding in synthesis of Core1 structures on O-linked glycans.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertCOSMC (C1GALT1C1 Human)
UseCRISPRAvailable sinceJuly 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLEW100v5-BSD-T7-sgRNA
Plasmid#245119PurposePlasmid backbone to for inserting a T7 promoter driven guide RNA into the rDNA spacer of T. bruceiDepositorTypeEmpty backboneUseCRISPRAvailable sinceApril 8, 2026AvailabilityAcademic Institutions and Nonprofits only -
H1_sgRNA(GRIN2B)_SauCas9
Plasmid#246054PurposeExpression of a sgRNA targeting the GRIN2B locus and SauCas9 under the same pol-III H1 promoterDepositorInsertSauCas9 and sgRNA(GRIN2B)
UseCRISPR and Synthetic BiologyExpressionMammalianAvailable sinceDec. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
MIGR1-U6gRNA2-Filler
Plasmid#237401PurposeFor the sequential insertion of two guide RNAs into two U6gRNA cassettes.DepositorInsertsU6gRNA-1
U6gRNA-2
PGK-TagBFP
UseCRISPR and RetroviralExpressionMammalianPromoterPGK promoter, U6 promoter, and U6, PGKAvailable sinceJune 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
sgRNA Clec12a (CT44)
Plasmid#236204Purposelentiviral expression of Cas9 and encodes CT44 sgRNA for CLEC12A deletionDepositorAvailable sinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
sgRNA Clec12a (CT47)
Plasmid#236205Purposelentiviral expression of Cas9 and encodes CT47 sgRNA for CLEC12A deletionDepositorAvailable sinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
REV7 C-terminal sgRNA
Plasmid#207095PurposepX330 based plasmid for expression of Cas9 and the GCTCATAAAGGCAGCTGAGG sgRNA to target the REV7 locus.DepositorInsertGCTCATAAAGGCAGCTGAGG
ExpressionMammalianPromoterCMV and U6Available sinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
Halo XLF sgRNA
Plasmid#207605PurposesgRNA for the insert of the HaloTag at the endogenous loci of XLFDepositorInsertGTTCTTCCATctgcaaaaaa
TagsNoneExpressionMammalianAvailable sinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only