We narrowed to 10,769 results for: yeast
-
Plasmid#122254Purposeexpression vector for mTFP under EFT3 promoterDepositorInsertmTFP
ExpressionWormPromoterEFT3Available sinceMarch 8, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
Efg1-C-PrLD
Plasmid#216398PurposeExpresses 6xHis-tagged C-terminal prion-like domains of Efg1DepositorInsertEfg1-C-PrLD
Tags6xHis-tagsExpressionBacterialAvailable sinceApril 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pXOOY
Plasmid#196449PurposeA dual vector for expression of membrane proteins in S. cerevisiae and X. laevisDepositorTypeEmpty backboneUseExpression in xenopus laevisExpressionYeastPromoteryeast CYC-GAL and T7 promoterAvailable sinceFeb. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
His-MBP-FL-Efg1
Plasmid#216395PurposeExpresses MBP-tagged full length Efg1DepositorInsertEfg1-FL
Tags6xHis tags-MBPExpressionBacterialAvailable sinceApril 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pML107-KAE1
Plasmid#232891PurposePlasmid expressing Cas9 and gRNA GATGACAACTGAATGCAGAG which targets the KAE1 gene.DepositorAvailable sinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-VHT1
Plasmid#232898PurposePlasmid expressing Cas9 and gRNA TGCGGCCACACTGAAATACG which targets the VHT1 gene.DepositorAvailable sinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ARB1
Plasmid#232888PurposePlasmid expressing Cas9 and gRNA CAAAAACTAACTGCTTACGG which targets the ARB1 gene.DepositorAvailable sinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-RER2
Plasmid#232884PurposePlasmid expressing Cas9 and gRNA AGAATCGCATCTCTACACGG which targets the RER2 gene.DepositorAvailable sinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-3
Plasmid#232894PurposePlasmid expressing Cas9 and gRNA GTTCTTAACTAGGATCATGG which targets the RER2 gene.DepositorAvailable sinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-AVO1
Plasmid#232889PurposePlasmid expressing Cas9 and gRNA AATGATGACGACCATACCAG which targets the AVO1 gene.DepositorAvailable sinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-YFR054C
Plasmid#232900PurposePlasmid expressing Cas9 and gRNA GCTCAAAGAAACAATTAGAG which targets the YFR054C gene.DepositorAvailable sinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-SRP14
Plasmid#232896PurposePlasmid expressing Cas9 and gRNA GAAAACAAAATGCTCAACAG which targets the SRP14 gene.DepositorAvailable sinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-TLG1
Plasmid#232897PurposePlasmid expressing Cas9 and gRNA GATGAAAACGAAGACGTGAG which targets the TLG1 gene.DepositorAvailable sinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-2
Plasmid#232883PurposePlasmid expressing Cas9 and gRNA GGTAGTGTTAGACCTGAACA which targets the LEU2 gene.DepositorAvailable sinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-INO80
Plasmid#232890PurposePlasmid expressing Cas9 and gRNA GGAAGTAGAATCATTCGTAG which targets the INO80 gene.DepositorAvailable sinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ZIM17
Plasmid#232901PurposePlasmid expressing Cas9 and gRNA AAATGTCTCACTTTGCAGTG which targets the ZIM17 gene.DepositorAvailable sinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-LAS17
Plasmid#232892PurposePlasmid expressing Cas9 and gRNA AATACCCTGAATTCTGCCGG which targets the LAS17 gene.DepositorAvailable sinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
Efg1-ΔDBD
Plasmid#216396PurposeExpresses 6xHis-tagged N- and C-terminal prion-like domains of Efg1DepositorInsertEfg1-ΔDBD
Tags6xHis-tagsExpressionBacterialMutationdeleted amino acids 182-356Available sinceApril 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pML107-SAM50
Plasmid#232895PurposePlasmid expressing Cas9 and gRNA AATAGTTTATGTAAGAACAG which targets the SAM50 gene.DepositorAvailable sinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HIS3-3
Plasmid#232882PurposePlasmid expressing Cas9 and gRNA AAACCTTTTTACTCCACGCA which targets the HIS3 gene.DepositorAvailable sinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only