We narrowed to 10,769 results for: yeast
-
Plasmid#232881PurposePlasmid expressing Cas9 and gRNA CCAAGTTCGACAACTGCGTA which targets the HIS3 gene.DepositorAvailable sinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pML107-ADE13
Plasmid#232887PurposePlasmid expressing Cas9 and gRNA GTAGCAGCAAAAGAAGACAA which targets the ADE13 gene.DepositorAvailable sinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
Efg1-DBD
Plasmid#216399PurposeExpresses 6xHis-tagged DBD of Efg1DepositorInsertEfg1-DBD
Tags6xHis-tagsExpressionBacterialMutationdeleted amino acids 2-181 and 357-554Available sinceApril 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pML107-NET1
Plasmid#232893PurposePlasmid expressing Cas9 and gRNA GTGCCACTAATGGATCCATG which targets the NET1 gene.DepositorAvailable sinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-VRG4
Plasmid#232899PurposePlasmid expressing Cas9 and gRNA TCGCATAGCCCAGTATACGT which targets the VRG4 gene.DepositorAvailable sinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pESC/CURT_fluoD
Plasmid#118001PurposeExpression of CURT_flouD controlled by the Gal1 promoterDepositorInsertCURT_flouD
UseYeast/bacteria binary vectorExpressionYeastPromoterGal1Available sinceMarch 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
Efg1-ΔDBD-Q443P
Plasmid#216401PurposeExpresses 6xHis-tagged N- and C-terminal prion-like domains of Efg1 with Q443 to proline mutationDepositorInsertEfg1-ΔDBD-Q443P
Tags6xHis-tagsExpressionBacterialMutationchanged Glutamine 443 to Proline, and deleted ami…Available sinceApril 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
Efg1-ΔDBD-A51P/A56P
Plasmid#216400PurposeExpresses 6xHis-tagged N- and C-terminal prion-like domains of Efg1 with A51/A56 to proline mutationsDepositorInsertEfg1-ΔDBD-A51P/A56P
Tags6xHis-tagsExpressionBacterialMutationchanged Alanine 51 and 56 to Proline, and deleted…Available sinceApril 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTH339-SUP45(1-138)-GalBD
Plasmid#29739DepositorInsertSUP45 (SUP45 Budding Yeast)
TagsGal Activation domain and MycExpressionYeastMutationCodons 1-138 of the yeast SUP45 gene onlyAvailable sinceSept. 13, 2011AvailabilityAcademic Institutions and Nonprofits only -
pTH341-SUP45(139-437)-GalBD
Plasmid#29741DepositorInsertSUP45 (SUP45 Budding Yeast)
TagsGal Activation domain and MycExpressionYeastMutationCodons 139-437 of the yeast SUP45 gene onlyAvailable sinceSept. 21, 2011AvailabilityAcademic Institutions and Nonprofits only -
pTH342-SUP45(276-437)-GalBD
Plasmid#29742DepositorInsertSUP45 (SUP45 Budding Yeast)
TagsGal Activation domain and MycExpressionYeastMutationCodons 276-437 of the yeast SUP45 gene onlyAvailable sinceSept. 13, 2011AvailabilityAcademic Institutions and Nonprofits only -
Efg1-ΔDBD-Y4S/Y8S/Y16S
Plasmid#216405PurposeExpresses 6xHis-tagged N- and C-terminal prion-like domains of Efg1 with Y4/Y8/Y16 to serine mutationsDepositorInsertEfg1-ΔDBD-Y4S/Y8S/Y16S
Tags6xHis-tagsExpressionBacterialMutationchanged Tyrosine 4, 8 and 16 to Serine, and delet…Available sinceApril 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
Efg1-ΔDBD-Y64S/Y66S/Y69S
Plasmid#216406PurposeExpresses 6xHis-tagged N- and C-terminal prion-like domains of Efg1 with Y64/Y66/Y69 to serine mutationsDepositorInsertEfg1-ΔDBD-Y64S/Y66S/Y69S
Tags6xHis-tagsExpressionBacterialMutationchanged Tyrosine 64, 66 and 69 to Serine, and del…Available sinceApril 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTH738-CENBEVYslow
Plasmid#38220DepositorInsertGCN4-based single uORF-containing 5'-UTR
ExpressionYeastMutationThe start codons of uORFs2, 3 and4 of the yeast G…PromoterTDH3 (=GPD)Available sinceDec. 19, 2012AvailabilityAcademic Institutions and Nonprofits only -
Efg1-ΔDBD-Y115S/Y132S/Y139S
Plasmid#216408PurposeExpresses 6xHis-tagged N- and C-terminal prion-like domains of Efg1 with Y115/Y132/Y139 to serine mutationsDepositorInsertEfg1-ΔDBD-Y115S/Y132S/Y139S
Tags6xHis-tagsExpressionBacterialMutationchanged Tyrosine 115, 132 and 139 to Serine, and …Available sinceJuly 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
Efg1-ΔDBD-A51P/A56P/Q443P
Plasmid#216402PurposeExpresses 6xHis-tagged N- and C-terminal prion-like domains of Efg1 with A51/A56/Q443 to proline mutationsDepositorInsertEfg1-ΔDBD-A51P/A56P/Q443P
Tags6xHis-tagsExpressionBacterialMutationchanged Alanine 51, 56 and Glutamine 443 to Proli…Available sinceApril 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
Efg1-ΔDBD-Y101S/Y104S/Y106S
Plasmid#216407PurposeExpresses 6xHis-tagged N- and C-terminal prion-like domains of Efg1 with Y101/Y104/Y106 to serine mutationsDepositorInsertEfg1-ΔDBD-Y101S/Y104S/Y106S
Tags6xHis-tagsExpressionBacterialMutationchanged Tyrosine 101, 104 and 106 to Serine, and …Available sinceApril 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
Efg1-ΔDBD-Y401S/Y404S/Y409S
Plasmid#216409PurposeExpresses 6xHis-tagged N- and C-terminal prion-like domains of Efg1 with Y401/Y404/Y409 to serine mutationsDepositorInsertEfg1-ΔDBD-Y401S/Y404S/Y409S
Tags6xHis-tagsExpressionBacterialMutationchanged Tyrosine 401, 404 and 409 to Serine, and …Available sinceApril 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
Efg1-ΔDBD-Y450S/Y452S/Y456S
Plasmid#216410PurposeExpresses 6xHis-tagged N- and C-terminal prion-like domains of Efg1 with Y450/Y452/Y456 to serine mutationsDepositorInsertEfg1-ΔDBD-Y450S/Y452S/Y456S
Tags6xHis-tagsExpressionBacterialMutationchanged Tyrosine 450, 452 and 456 to Serine, and …Available sinceApril 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
Efg1-ΔDBD-Y478S/Y482S/Y484S
Plasmid#216411PurposeExpresses 6xHis-tagged N- and C-terminal prion-like domains of Efg1 with Y478/Y482/Y484 to serine mutationsDepositorInsertEfg1-ΔDBD-Y478S/Y482S/Y484S
Tags6xHis-tagsExpressionBacterialMutationchanged Tyrosine 478, 482 and 484 to Serine, and …Available sinceApril 17, 2024AvailabilityAcademic Institutions and Nonprofits only