We narrowed to 24,291 results for: Sis
-
Plasmid#32623DepositorInsertGAPDH shRNA #3
UseRNAiAvailable SinceAug. 1, 2013AvailabilityAcademic Institutions and Nonprofits only -
pZZ006-AlcA::DM2h[Bla-1] G301A K302A-Myc
Plasmid#246383PurposeStable transformation or transient expression of gene if interests in plantsDepositorInsertDM2h[Bla-1] (AT3G44670 Mustard Weed)
ExpressionPlantMutationTGGGATTGGTAAGACAACTAT to TGGGATTGCTGCGACAACTAT am…Available SinceMay 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
pZZ006-AlcA::DM2h[Bla-1] S111A H112A-Myc
Plasmid#246382PurposeStable transformation or transient expression of gene if interests in plantsDepositorInsertDM2h[Bla-1] (AT3G44670 Mustard Weed)
ExpressionPlantMutationCCATTCTTAGTCACATCCTCGAA to AAAACCATTCTTGCTGCTATCC…Available SinceMay 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
pMR10 pLac tipR
Plasmid#251527PurposepMR10 plasmid harbouring tipR gene (CCNA_00852) for complementationDepositorInserttipR (CCNA_00852)
ExpressionBacterialAvailable SinceApril 21, 2026AvailabilityAcademic Institutions and Nonprofits only -
pMR10 acrAB2nodT
Plasmid#251526PurposepMR10 plasmid harbouring acrAB2nodT operon (CCNA_00849:51) for complementationDepositorInsertRND efflux pump acrAB2nodT
ExpressionBacterialAvailable SinceApril 21, 2026AvailabilityAcademic Institutions and Nonprofits only -
pFSD
Plasmid#250975PurposeMinimal replicative empty plasmid for Shewanella sp.DepositorTypeEmpty backboneExpressionBacterialAvailable SinceMarch 25, 2026AvailabilityAcademic Institutions and Nonprofits only -
pICSL12002
Plasmid#245626PurposeLevel 0 Golden Gate part pAt6: Ubiquitin / AtUbl5 (At5g42300) promoter, GGAG - AATGDepositorInsertpAt6: Ubiquitin / AtUbl5 (At5g42300) promoter
UseSynthetic BiologyMutationBsaI/BpiI sites removed by point-mutationAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pICSL12030
Plasmid#245637PurposeLevel 0 Golden Gate part pAt1: Tip Delta (AT3g16240) promoter, GGAG - AATGDepositorInsertpAt1: Tip Delta (AT3g16240) promoter
UseSynthetic BiologyMutationBsaI/BpiI sites removed by point-mutationAvailable SinceJan. 5, 2026AvailabilityAcademic Institutions and Nonprofits only -
pICSL12028
Plasmid#245635PurposeLevel 0 Golden Gate part pAt2: Rib Prot16 (At4g34620) promoter, GGAG - AATGDepositorInsertpAt2: Rib Prot16 (At4g34620) promoter
UseSynthetic BiologyMutationBsaI/BpiI sites removed by point-mutationAvailable SinceDec. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pICSL12029
Plasmid#245636PurposeLevel 0 Golden Gate part pAt5: XET (At5g65730) promoter, GGAG - AATGDepositorInsertpAt5: XET (At5g65730) promoter
UseSynthetic BiologyMutationBsaI/BpiI sites removed by point-mutationAvailable SinceDec. 17, 2025AvailabilityAcademic Institutions and Nonprofits only