We narrowed to 119,357 results for: MPI
-
Plasmid#232887PurposePlasmid expressing Cas9 and gRNA GTAGCAGCAAAAGAAGACAA which targets the ADE13 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pML107-LAS17
Plasmid#232892PurposePlasmid expressing Cas9 and gRNA AATACCCTGAATTCTGCCGG which targets the LAS17 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS313-rad53-5004
Plasmid#232902PurposePlasmid carrying the rad53-5004 allele with its native promoter and terminator.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
3'dmDR-CMV-CasRx-bGHpolyA
Plasmid#229556PurposeExpresses CasRx (RfxCas13d) with double processed direct repeats (15nt) and a non-target spacer in between at 3' endDepositorInsertCasRx
UseCRISPRExpressionMammalianAvailable SinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
1203U-U6-gRNA-pCMV-wtCas9-NG-P2A-mcherry-3'dmDR
Plasmid#221448PurposeExpresses wtCas9-NG with double processed direct repeats (15nt) and a non-target spacer in between at 3' end, mCherry tag, and the gRNA targeting HEK293T-site3DepositorInsertswtCas9-NG
mCherry
UseCRISPRExpressionMammalianAvailable SinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMX-Flag-GFP_EDIL3
Plasmid#227957PurposeCo-localisation experimentDepositorAvailable SinceFeb. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCCG_nit9fl_CNX1_linker
Plasmid#228414PurposeExpression of NIT-9 with CNX1 linkage region in N. crassa at the his-3 locusDepositorInsertNIT-9 (AT5G61790 Mustard Weed)
UseProtein expression in n. crassaMutationremoval of the linkage region and insertion of th…Available SinceJan. 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
SJZ10
Plasmid#228270PurposePlasmid backboneDepositorTypeEmpty backboneExpressionBacterialAvailable SinceJan. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBS-ACTB-C200-T7
Plasmid#229850PurposeDonor vector for the ACTB site containing T7 sequence for detection of HR products.DepositorInsertPartial sequence of ACTB gene
UseHr donor vector for human actb gene.Available SinceJan. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCG-scr
Plasmid#229847PurposeExpresses wild-type Cas9 and scrambled gRNA.DepositorInsertguide RNA with scrambled sequence
UseCRISPRExpressionMammalianAvailable SinceJan. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDual_dsCas9_Venus_hs_NC_chr1
Plasmid#214682PurposeLentiviral expression vector for an inducible Cas9-P2A-Venus with two sgRNA sequences against human non-coding DNA region of chromosome 1 (negative control)DepositorInsertdgRNA_Chr1
UseCRISPR and LentiviralAvailable SinceDec. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDual_dsCas9_Venus_hs_NC_chr2
Plasmid#214683PurposeLentiviral expression vector for an inducible Cas9-P2A-Venus with two sgRNA sequences against human non-coding DNA region of chromosome 2 (negative control)DepositorInsertdgRNA_Chr2
UseCRISPR and LentiviralAvailable SinceDec. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDual_dsCas9_Venus_hs_TP73
Plasmid#214685PurposeLentiviral expression vector for an inducible Cas9-P2A-Venus with two sgRNA sequences against human TP73DepositorInsertdgRNA_TP73 (TP73 Human)
UseCRISPR and LentiviralAvailable SinceDec. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDual_dsCas9_BFP_hs_NC_chr1
Plasmid#214686PurposeLentiviral expression vector for an inducible Cas9-P2A-BFP with two sgRNA sequences against human non-coding DNA region of chromosome 1 (negative control)DepositorInsertdgRNA_Chr1
UseCRISPR and LentiviralAvailable SinceDec. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDual_dsCas9_BFP_hs_TP73
Plasmid#214687PurposeLentiviral expression vector for an inducible Cas9-P2A-BFP with two sgRNA sequences against human TP73DepositorInsertdgRNA_TP73 (TP73 Human)
UseCRISPR and LentiviralAvailable SinceDec. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
SJZ9
Plasmid#228269PurposePlasmid backboneDepositorTypeEmpty backboneExpressionBacterialAvailable SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
SJZ2
Plasmid#228264PurposePlasmid backboneDepositorTypeEmpty backboneExpressionBacterialAvailable SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMX-Flag-GFP_TMEM256
Plasmid#227955PurposeCo-localisation experimentDepositorAvailable SinceDec. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMX-Flag-GFP_CBLN3
Plasmid#227950PurposeCo-localisation experimentDepositorAvailable SinceDec. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pOliSpec3'
Plasmid#228550PurposeTemplate for PCR amplification for gRNA cloning. The PCR product recombines in vivo with a PCRs products from pOliSpec5' and oligo-spacer amplifications, to clone gRNA plasmid.DepositorInsertTruncated 3' region of aadA
UseCRISPRAvailable SinceDec. 2, 2024AvailabilityAcademic Institutions and Nonprofits only