We narrowed to 14,951 results for: RING;
-
Plasmid#221831PurposePlasmid to express gRNA2 (gggattcgagcggcccgtcg) for editing at the beginning of Drosophila SERT coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pACUH 5-HT2BR-7xGFP11-HA
Plasmid#221840PurposePlasmid for generating 10xUAS-5-HT2BR-7xGFP11-HA transgenic flies with attP/attB integration. It carries the attB sequence.DepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCR197
Plasmid#240643PurposeExpression of the tri-cistronic construct NES-AmNeonGreen-P2A-mTurquoise2-NLS-T2A-mScarlet-I-PTS1 in Exaiptasia diaphana; In vitro transcription of the same construct via SP6 polymeraseDepositorInsertsAIPGENE865 promoter
SP6 promoter
AmNeonGreen
mTurquoise2
mScarlet-I
UseGene expression and genomic integration in fishTagsNES (from Exaiptasia diaphana MEK2), NLS (from SV…MutationCodon-optimized for Exaiptasia diaphana, amino ac…Available SinceAug. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
mCh-CRY2-sspB2
Plasmid#223691PurposePhoBIT2 component; sspB2 (sspB mutant A56F) fused to mCh-CRY2PHRDepositorAvailable SinceJuly 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAG-HA-Sema7A
Plasmid#190644PurposeExpresses Mouse Sema7A with HA TagDepositorAvailable SinceJuly 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-miR30-shJAG1 #4
Plasmid#171197PurposeRetroviral vector for U6 promoter driven expression empty miR30 based shJAG1 #4 (to be used in conjunction with Phoenix packaging cells).DepositorInsertshJAG1 #4
UseRetroviralExpressionMammalianPromoterU6Available SinceMay 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
EW209 PGK-ZNF35(5-8)-ZNF35(5-8)-deImmunLink-NZF(FLP-IN)
Plasmid#236135PurposePlasmid encoding the ZNF35/ZNF35 zinc finger array attached by a deimmunized linker to the NZF transcriptional activation domain, under control of PGK promoterDepositorInsertZNF35(5-8)-ZNF35(5-8)-deImmunLink-NZF
ExpressionMammalianPromoterPGKAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
JPZF3 CMV-TO-SCN1A-117-NZF
Plasmid#236164PurposePlasmid encoding the SCN1A-117 zinc finger array attached by a GS linker to the NZF transcriptional activation domain, under control of CMV promoter with two TetR binding sitesDepositorInsertSCN1A-117-NZF
ExpressionMammalianPromoterCMV promoter with two TetR binding sitesAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
JPZF10 CMV-TO-SCN1A-372-NZF
Plasmid#236171PurposePlasmid encoding the SCN1A-372 zinc finger array attached by a GS linker to the NZF transcriptional activation domain, under control of CMV promoter with two TetR binding sitesDepositorInsertSCN1A-372-NZF
ExpressionMammalianPromoterCMV promoter with two TetR binding sitesAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFNC-2
Plasmid#227667PurposePlasmid encoding the BxbI phage integrase. It can be used to remove the antibiotic resistance cassette integrated with pCIFR. KmR, easily curable via sucrose counterselection.DepositorInsertKmR
ExpressionBacterialAvailable SinceApril 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCIFR-5
Plasmid#233294PurposeIntegration of msfGFP (or your Module Of Interest) in a random fashion via Tn5 insertion. The antibiotic cassette used for selecting for the integration can be removed in a later stage with pFNC.DepositorInsertmsfGFP
Promoterp14G-BCD2Available SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
EW215 PGK-ZNF35(5-8)-deImmunLink-NZF(FLP-IN)
Plasmid#236130PurposePlasmid encoding the ZNF35-derived portion of the ZNF35/ZNF250 zinc finger array attached by a deimmunized linker to the NZF transcriptional activation domain, under control of PGK promoterDepositorInsertZNF35(5-8)-deImmunLink-NZF
ExpressionMammalianPromoterPGKAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
JPZF4 CMV-TO-SCN1A-383-NZF
Plasmid#236165PurposePlasmid encoding the SCN1A-383 zinc finger array attached by a GS linker to the NZF transcriptional activation domain, under control of CMV promoter with two TetR binding sitesDepositorInsertSCN1A-383-NZF
ExpressionMammalianPromoterCMV promoter with two TetR binding sitesAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
JPZF5 CMV-TO-SCN1A-472-NZF
Plasmid#236166PurposePlasmid encoding the SCN1A-472 zinc finger array attached by a GS linker to the NZF transcriptional activation domain, under control of CMV promoter with two TetR binding sitesDepositorInsertSCN1A-472-NZF
ExpressionMammalianPromoterCMV promoter with two TetR binding sitesAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
EW196 PGK-ZNF35(5-8)-ZNF250(1-4)-deImmunLink-NZF(FLP-IN)
Plasmid#236132PurposePlasmid encoding the ZNF35/ZNF250 zinc finger array attached by a deimmunized linker to the NZF transcriptional activation domain, under control of PGK promoterDepositorInsertZNF35(5-8)-ZNF250(1-4)-deImmunLink-NZF
ExpressionMammalianPromoterPGKAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
EW269 CMV-TO-Gal4-NZF[GS Linkers] (FLP-IN)
Plasmid#236122PurposePlasmid encoding Gal4-NZF transcription factor with GS linkers between the component domains of NZF, under control of CMV promoter with two TetR binding sitesDepositorInsertGal4-NZF (GS Linkers)
ExpressionMammalianPromoterCMV promoter with two TetR binding sitesAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
EW434 4x(ZNF35/ZNF35tar)-SFFV-GFP
Plasmid#236143PurposeFluorescent reporter encoding GFP under control of SFFV promoter with four ZNF35/ZNF35 binding sites upstreamDepositorInsertEGFP
ExpressionMammalianPromoterSFFV promoter with four ZNF35/ZNF35 binding sites…Available SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
EW216 PGK-ZNF250(1-4)-deImmunLink-NZF(FLP-IN)
Plasmid#236131PurposePlasmid encoding the ZNF250-derived portion of the ZNF35/ZNF250 zinc finger array attached by a deimmunized linker to the NZF transcriptional activation domain, under control of PGK promoterDepositorInsertZNF250(1-4)-deImmunLink-NZF
ExpressionMammalianPromoterPGKAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
JPZF9 CMV-TO-SCN1A-371-NZF
Plasmid#236170PurposePlasmid encoding the SCN1A-371 zinc finger array attached by a GS linker to the NZF transcriptional activation domain, under control of CMV promoter with two TetR binding sitesDepositorInsertSCN1A-371-NZF
ExpressionMammalianPromoterCMV promoter with two TetR binding sitesAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
EW415 PGK-ZNF35(5-8)-IKZF1(2-3)-realDeimmunLink-NZF (FLP-IN)
Plasmid#236136PurposePlasmid encoding the ZNF35/ZNFIKZF1 zinc finger array attached by a deimmunized linker to the NZF transcriptional activation domain, under control of PGK promoterDepositorInsertZNF35/IKZF1(2-3)-deimmunLink-NZF
ExpressionMammalianPromoterPGKAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only