We narrowed to 5,259 results for: crispr cas9 grna plasmid
-
Plasmid#236203Purposelentiviral expression of Cas9 and encodes CT6 sgRNA for CLEC12A deletionDepositorAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only
-
sgRNA Clec12a (CT44)
Plasmid#236204Purposelentiviral expression of Cas9 and encodes CT44 sgRNA for CLEC12A deletionDepositorAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
sgRNA Clec12a (CT47)
Plasmid#236205Purposelentiviral expression of Cas9 and encodes CT47 sgRNA for CLEC12A deletionDepositorAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
REV7 C-terminal sgRNA
Plasmid#207095PurposepX330 based plasmid for expression of Cas9 and the GCTCATAAAGGCAGCTGAGG sgRNA to target the REV7 locus.DepositorInsertGCTCATAAAGGCAGCTGAGG
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pICH86966::AtU6p::sgRNA:NbVPE1a/b
Plasmid#223218PurposeExpresses an sgRNA targeting the NbVPE1a/b genes in Nicotiana benthamiana with an Arabidopsis U6 promoterDepositorInsertNbVPE1a/b
UseCRISPR and Synthetic BiologyTagsNoneExpressionPlantPromoterArabidopsis U6 promoterAvailable SinceOct. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pICH86966::AtU6p::sgRNA:NbCysP6
Plasmid#223217PurposeExpresses an sgRNA targeting the NbCysP6 gene in Nicotiana benthamiana with an Arabidopsis U6 promoterDepositorInsertNbCysP6 sgRNA
UseCRISPR and Synthetic BiologyTagsNoneExpressionPlantPromoterArabidopsis U6 promoterAvailable SinceOct. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 N-terminal sgRNA
Plasmid#207094PurposepX330 based plasmid for expression of Cas9 and the TTACTGCAGAATGACTACAG sgRNA to target the SHLD3 locus.DepositorInsertTTACTGCAGAATGACTACAG
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
NBS1 C-terminal sgRNA
Plasmid#207092PurposepX330 based plasmid for expression of Cas9 and the TAAAAAGGAGAAGATAACTG sgRNA to target the NBS1 locus.DepositorInsertTAAAAAGGAGAAGATAACTG
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
RNF169 C-terminal sgRNA
Plasmid#207099PurposepX330 based plasmid for expression of Cas9 and the ACACTTCATTAGGTGCTACT sgRNA to target the RNF169 locus.DepositorInsertACACTTCATTAGGTGCTACT
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD1 N-terminal sgRNA
Plasmid#207101PurposepX330 based plasmid for expression of Cas9 and the ATGGCAGGACTATGGCAGCC sgRNA to target the SHLD1 locus.DepositorInsertATGGCAGGACTATGGCAGCC
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only