We narrowed to 17,257 results for: form
-
Plasmid#99568Purposemammalian expression of mutant TMEM230 (isoform 2) and ZsGreenDepositorAvailable SinceAug. 18, 2017AvailabilityAcademic Institutions and Nonprofits only
-
TMEM230-M3/Y92C-IRES(isoform 2)
Plasmid#99567Purposemammalian expression of mutant TMEM230 (isoform 2) and ZsGreenDepositorAvailable SinceAug. 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
TMEM230-M2/X184W-IRES(isoform 2)
Plasmid#99566Purposemammalian expression of mutant TMEM230 (isoform 2) and ZsGreenDepositorAvailable SinceAug. 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
TMEM230-M1/R141L-IRES(isoform 2)
Plasmid#99565Purposemammalian expression of mutant TMEM230 (isoform 2) and ZsGreenDepositorAvailable SinceAug. 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
isoform PKC Beta (JCE694)
Plasmid#182024Purposeyeast expression of mouse PKC Beta with yeast PKC1 promoter and ADH1 terminatorDepositorAvailable SinceMay 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
TMEM230-M2/X184W-IRES(isoform 1)
Plasmid#99560Purposemammalian expression of mutant TMEM230 (isoform 1) and ZsGreenDepositorAvailable SinceAug. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
TMEM230-M1/R141L-IRES(isoform 1)
Plasmid#99559Purposemammalian expression of mutant TMEM230 (isoform 1) and ZsGreenDepositorAvailable SinceAug. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
isoform PKC Gamma (JCE692)
Plasmid#89780Purposeyeast expression of mouse PKC Gamma with yeast PKC1 promoter and ADH1 terminatorDepositorAvailable SinceMay 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-5-HT2AR-isoformD
Plasmid#221823PurposePlasmid to express gRNA1 (tccttctggcgcaaacacgg) for editing at the end of Drosophila 5-HT2AR isoform D coding frameDepositorInsertd5-HT2AR isoform D gRNA1 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterDrosophila U6 promoterAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT2AR-isoformD
Plasmid#221824PurposePlasmid to express gRNA2 (ctgaagacataattacgtgg) for editing at the end of Drosophila 5-HT2AR isoform D coding frameDepositorInsertd5-HT2AR isoform D gRNA2 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-5-HT2AR-isoformBFH
Plasmid#221825PurposePlasmid to express gRNA1 (cgctatcggtctgtgacaga) for editing at the end of Drosophila 5-HT2AR isoforms B, F and H coding frameDepositorInsertd5-HT2AR isoforms BFH gRNA1 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT2AR-isoformBFH
Plasmid#221826PurposePlasmid to express gRNA2 (ggaaaagccgctaattacag) for editing at the end of Drosophila 5-HT2AR isoforms B, F and H coding frameDepositorInsertd5-HT2AR isoforms BFH gRNA2 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterDrosophila U6 promoterAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1-λN-HA-NOT1 isoform C (JM155)
Plasmid#206449PurposeNot1 expression in Schneider cells for imagingDepositorAvailable SinceJuly 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1-λN-HA-CAF1 isoform A (HK101)
Plasmid#206448PurposeCAF1 expression in Schneider cells for imagingDepositorAvailable SinceJuly 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti_CMVTRE3G_LYSET-Isoform2-I142V-Flag
Plasmid#192006PurposeLentiviral vector to generate flag-tagged LYSET(TMEM251)-isoform2 I142V mutant stable expressing cell line under CMVTRE3G promoterDepositorInsertLYSET-Isoform2-I142V-Flag (LYSET Human)
UseLentiviralTagsFlagExpressionMammalianPromoterCMVTRE3GAvailable SinceOct. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti_CMVTRE3G_LYSET-Isoform2-R45W-Flag
Plasmid#192005PurposeLentiviral vector to generate flag-tagged LYSET(TMEM251)-isoform2 R45W mutant stable expressing cell line under CMVTRE3G promoterDepositorInsertLYSET-Isoform2-R45W (LYSET Human)
UseLentiviralTagsFlagExpressionMammalianPromoterCMVTRE3GAvailable SinceOct. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
isoform PKC Theta (JCE782)
Plasmid#182026Purposeyeast expression of mouse PKC Theta with yeast PKC1 promoter and ADH1 terminatorDepositorAvailable SinceMay 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
isoform PKC Epsilon (JCE592)
Plasmid#89776Purposeyeast expression of mouse PKC Epsilon with yeast PKC1 promoter and ADH1 terminatorDepositorAvailable SinceMay 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
isoform PKC Eta (JCE615)
Plasmid#89774Purposeyeast expression of mouse PKC Eta with yeast PKC1 promoter and ADH1 terminatorDepositorAvailable SinceApril 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTC16-dmd-1, splice form 3
Plasmid#44694DepositorInsertSmed-dmd-1, spice form 3
UseT/a cloning vector for dsrna generation and the g…Available SinceMay 29, 2013AvailabilityAcademic Institutions and Nonprofits only