We narrowed to 1,681 results for: sfGFP
-
Plasmid#133531PurposesfGFP driven by a T7 promoter with the tetO sequence 13 bp downstream from the promoter start siteDepositorInsertsfGFP
TagsStrep tag and TEV siteExpressionBacterialMutationWTPromoterT7Available SinceDec. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pY71-tet.I.9
Plasmid#133530PurposesfGFP driven by a T7 promoter with the tetO sequence 12 bp downstream from the promoter start siteDepositorInsertsfGFP
TagsStrep tag and TEV siteExpressionBacterialMutationWTPromoterT7Available SinceDec. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pY71-tet.I.7
Plasmid#133529PurposesfGFP driven by a T7 promoter with the tetO sequence 10 bp downstream from the promoter start siteDepositorInsertsfGFP
TagsStrep tag and TEV siteExpressionBacterialMutationWTPromoterT7Available SinceDec. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pY71-tet.I.6
Plasmid#133528PurposesfGFP driven by a T7 promoter with the tetO sequence 9 bp downstream from the promoter start siteDepositorInsertsfGFP
TagsStrep tag and TEV siteExpressionBacterialMutationWTPromoterT7Available SinceDec. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pY71-tet.I.5
Plasmid#133527PurposesfGFP driven by a T7 promoter with the tetO sequence 8 bp downstream from the promoter start siteDepositorInsertsfGFP
TagsStrep tag and TEV siteExpressionBacterialMutationWTPromoterT7Available SinceDec. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pY71-tet.I.3
Plasmid#133525PurposesfGFP driven by a T7 promoter with the tetO sequence 6 bp downstream from the promoter start siteDepositorInsertsfGFP
TagsStrep tag and TEV siteExpressionBacterialMutationWTPromoterT7Available SinceDec. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pY71-tet.I.2
Plasmid#133524PurposesfGFP driven by a T7 promoter with the tetO sequence 5 bp downstream from the promoter start siteDepositorInsertsfGFP
TagsStrep tag and TEV siteExpressionBacterialMutationWTPromoterT7Available SinceDec. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pY71-tet.I.4
Plasmid#133526PurposesfGFP driven by a T7 promoter with the tetO sequence 7 bp downstream from the promoter start siteDepositorInsertsfGFP
TagsStrep tag and TEV siteExpressionBacterialMutationWTPromoterT7Available SinceDec. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pY71-tet.I.1
Plasmid#133523PurposesfGFP driven by a T7 promoter with the tetO sequence 4 bp downstream from the promoter start siteDepositorInsertsfGFP
TagsStrep tag and TEV siteExpressionBacterialMutationWTPromoterT7Available SinceDec. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJBL7049
Plasmid#167219Purposecell-free arsenic sensing reporterDepositorInsertpArs-sfGFP
UseSynthetic BiologyAvailable SinceJan. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJBL7050
Plasmid#167220Purposecell-free mercury sensing reporterDepositorInsertpMer-sfGFP
UseSynthetic BiologyAvailable SinceJan. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJBL7051
Plasmid#167221Purposecell-free cadmium sensing reporterDepositorInsertpCad-sfGFP
UseSynthetic BiologyAvailable SinceJan. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJBL7053
Plasmid#167222Purposecell-free lead sensing reporterDepositorInsertpPbr-sfGFP
UseSynthetic BiologyAvailable SinceJan. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJBL7054
Plasmid#167223Purposecell-free copper sensing reporterDepositorInsertpCue-sfGFP
UseSynthetic BiologyAvailable SinceJan. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQ-dzCas9-Act3.0
Plasmid#158414PurposeCRISPR-Act3.0 system containing dzCas9-VP64 fusion protein, T2A linked MS2-SunTag fusion protein, and ScFv-sfGFP-2xTAD activator.DepositorInsertdzCas9-VP64-T2A-MS2-SunTag-rbcS-E9t-ter-ZmUbi-scFv-sfGFP-2xTAD-GB1-NOS-ter
UseCRISPRExpressionPlantAvailable SinceJuly 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pYPQ-Cas9-Act3.0
Plasmid#178954PurposeIt consists of a catalytically active Cas9 nuclease and MS2-SunTag-activators activation complex (ScFv-sfGFP-2xTAD), enabling simultaneous genome editing and gene activation.DepositorInsertzCas9-T2A-MS2-SunTag-rbcS-E9t-ter-ZmUbi-scFv-sfGFP-2xTAD-GB1-NOS-ter
UseCRISPRExpressionPlantAvailable SinceMay 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
scFv-GCN4-DNMT3a(R887E)-DNMT3l
Plasmid#154141PurposeExpresses a higher specificity variant of scFv-GCN4-DNMT3a-DNMT3l, contains R887E mutation in DNMT3a. To be used with the dCas9-SunTag system for targeted DNA methylation.DepositorInsertscFv-GCN4, DNMT3a (catalytic domain), DNMT3l (C-terminal part), sfGFP
TagsHA and sfGFPExpressionMammalianMutationR887EPromoterSFFVAvailable SinceOct. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAP05
Plasmid#186261PurposesfGFP under light light responsive PEL222 promoter and EL222 under constitutively active BBa_J2305 promoterDepositorInsertsExpressionBacterialPromoterBBa_23105 (GGCTAGCTCAGTCCTAGGTACTATGCTAGC) and PE…Available SinceSept. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pYPQ-dSpRY-Act3.0
Plasmid#158416PurposeCRISPR-Act3.0 system containing dSpRYCas9-VP64 fusion protein, T2A linked MS2-SunTag fusion protein, and ScFv-sfGFP-2xTAD activator.DepositorInsertdSpRY-VP64-T2A-MS2-SunTag-rbcS-E9t-ter-ZmUbi-scFv-sfGFP-2xTAD-GB1-NOS-ter
UseCRISPRExpressionPlantAvailable SinceJuly 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
p416-TEF-membrane localization signal-tagBFP-wrmScarlet11-TEF terminator
Plasmid#158585PurposeExpresses membrane localized tagBFP with wrmScarlet11 C-terminal fusion in S. cerevisiaeDepositorInsertmembrane localization signal-tagBFP-wrmScarlet11
TagstagBFPExpressionYeastMutationGGGS linkerPromoterTEFAvailable SinceAug. 26, 2020AvailabilityAcademic Institutions and Nonprofits only