We narrowed to 10,607 results for: yeast
-
Plasmid#110687PurposeExpression of a fungal biosynthetic gene clusterDepositorInsertS_cerevisiae_ADH2-ORF1, S_bayanus_ADH2-ORF2, PCK1-ORF3
ExpressionYeastAvailable SinceMay 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCHKU37.1-2.2
Plasmid#110669PurposeExpression of a fungal biosynthetic gene clusterDepositorInsertPKS
TagsflagExpressionYeastAvailable SinceMay 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCHSU65.1-2.2
Plasmid#110677PurposeExpression of a fungal biosynthetic gene clusterDepositorInsertPKS
TagsflagExpressionYeastAvailable SinceMay 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCHSU71.1-2.2
Plasmid#110684PurposeExpression of a fungal biosynthetic gene clusterDepositorInsertPKS
TagsflagExpressionYeastAvailable SinceMay 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCHSU67.1-2.2
Plasmid#110679PurposeExpression of a fungal biosynthetic gene clusterDepositorInsertPKS
TagsflagExpressionYeastAvailable SinceMay 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCHKU32.1-2.2
Plasmid#110664PurposeExpression of a fungal biosynthetic gene clusterDepositorInsertPKS
TagsflagExpressionYeastAvailable SinceMay 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS805a
Plasmid#87408Purposep426_Cas9_gRNA-ARS805a without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS805a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBSWHhc-Lam
Plasmid#133902PurposeNegative control when used in combination with pAWH-largeT. Expression of Gal4BD-Bait hybrid protein. Homology regions for recombination with pAWHDepositorAvailabilityAcademic Institutions and Nonprofits only -
pYG026
Plasmid#65328Purposereporter plasmids used in YeastFab work, in which promoters could be inserted just upstream YFP(YEVenus) to drive its expression, also contains an mCherry gene driven by TEF2 promoter.DepositorInsertccdB
UseUnspecifiedAvailable SinceFeb. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDEST-QZ213
Plasmid#215484PurposeYeast expression plasmidDepositorTypeEmpty backboneExpressionYeastAvailable SinceApril 14, 2026AvailabilityAcademic Institutions and Nonprofits only -
pDEST-AD-CYH2
Plasmid#215483PurposeYeast expression plasmidDepositorTypeEmpty backboneExpressionYeastAvailable SinceApril 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
pDEST-AD-AR68
Plasmid#215485PurposeYeast expression plasmidDepositorTypeEmpty backboneExpressionYeastAvailable SinceApril 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
pDEST-DB
Plasmid#215482PurposeYeast expression plasmidDepositorTypeEmpty backboneExpressionYeastAvailable SinceApril 1, 2026AvailabilityAcademic Institutions and Nonprofits only -
pPICZc-HsACTB*-thymosinB-8His
Plasmid#111146PurposeExpresses human beta-actin fused with thymosin beta and a His tag.DepositorInsertACTB (ACTB Human)
UsePichia pastoris integrationTagsThymosin beta and a His-tagExpressionYeastPromoterAOX1Available SinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
WT (DVD)
Plasmid#184316PurposeTo study dynamics of G-actin using NMR spectroscopy.DepositorAvailable SinceMay 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEN-L1-K2-L2
Plasmid#80684PurposeGateway Entry vector containing a temperature-sensitive mouse DHFRDepositorUseSynthetic BiologyTags3xHAExpressionBacterial, Insect, Mammalia…Mutationmouse DHFR with N-terminal UbiquitinAvailable SinceAug. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAG416GAL-EMCV_3C
Plasmid#201941PurposeExpresses EMCV 3C protease from a GAL promoter with a URA3 markerDepositorAvailable SinceAug. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAG416GAL10-HRV-B14_3C
Plasmid#203466PurposeExpresses HRV-B14 3C protease from a GAL10 promoter with a URA3 markerDepositorAvailable SinceJuly 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAG426GAL-KUNV_NS2B-GS-NS3
Plasmid#203506PurposeExpresses KUNV NS2B-NS3 protease (with GS linker) from a GAL promoter with a URA3 markerDepositorInsertKUNV NS2B-GS-NS3
ExpressionYeastPromoterGAL1Available SinceJuly 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBGE3.0
Plasmid#165988PurposeMulti-host shuttle vector that can be transferred by conjugation and replicate in S. meliloti, E. coli, S. cerevisiae, and P. tricornutum. Contains S. meliloti pSymB origin and Nm/Kan resistance.DepositorInsertsRK2/RP4 origin of transfer
repA1B1C1
nourseothricin N-acetyl transferase
neomycin resistance
UseSynthetic Biology; Bacterial and yeast cloning; c…Available SinceDec. 2, 2022AvailabilityAcademic Institutions and Nonprofits only