We narrowed to 19,736 results for: Nov
-
Plasmid#110320PurposeTRCN0000048179 (Target GTCCCTGCATATCGTCATGTT), silence human ARL4C gene and express monomeric Kusabira-Orange2DepositorInsertARL4C (ARL4C Human, Homo sapiens)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceAug. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET21a - Ec-ClpX D144L
Plasmid#111514PurposeExpresses E. coli ClpX with a C-terminal His tag and a mutation from D144 to L144DepositorInsertClpX
TagsHis tagExpressionBacterialMutationAspartatic acid 144 to LeucinePromoterT7Available SinceJune 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.2
Plasmid#110324PurposeTRCN0000002620 (Target GCGATAAGTACCGTTGAGTTT), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Human, Homo sapiens)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.1
Plasmid#110323PurposeTRCN0000378630 (Target GATAAGTACCGTTGAGTTTG), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Human, Homo sapiens)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCR3-vsv-INCENP d543-746
Plasmid#108473Purposeexpression of vsv-INCENP d543-746DepositorInsertINCENP d543-746 AA (INCENP Human)
TagsVSVExpressionMammalianMutationDelta Alpha helix, aa543-746 deletedPromoterCMVAvailable SinceMay 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCR3-vsv-dCEN-Incenp
Plasmid#108479Purposeexpression of vsv-dCEN-INCENPDepositorInsertdCEN-INCENP (INCENP Human)
TagsVSVExpressionMammalianMutationCEN box removedPromoterCMVAvailable SinceMay 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
sgPYM1
Plasmid#105249Purposehuman PYM1 sgRNADepositorInsertsgRNA for PYM1
ExpressionMammalianAvailable SinceFeb. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAP1893-1
Plasmid#105248Purposehuman GFP11 with tagRFP 33bp downstream in Lamin A/C (recoded)DepositorInsertInsertion of GFP11 at cut tagRFP 33bp downstream (recoded *) in Lamin A/C (LMNA Human)
ExpressionBacterialAvailable SinceFeb. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shGBP1.2.mKO2
Plasmid#85210PurposeTRCN0000116120 (Target TGAGACGACGAAAGGCATGTA) for silencing GBP1 gene and express monomeric Kusabira-Orange2.DepositorInsertGBP1 (guanylate binding protein 1) (GBP1 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
MSCV-NSD3-short del(100-263)
Plasmid#72548Purposeexpresses 3*FLAG tagged human NSD3-short with 100-263 aa deletionDepositorInsertNSD3-short (NSD3 Human)
UseRetroviralTags3xFlag and SV40 NLSExpressionMammalianMutation100-263 aa deletionPromoterLTRAvailable SinceJan. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pET30Xa-SBL1(160E)
Plasmid#66846PurposeExpresses soybean lipoxygenase-1 S160E mutant with N-term HistagDepositorTagsHis-tagExpressionBacterialMutationS160EPromoterT7lacAvailable SinceSept. 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pET30-SBL1(160S,HisTagDel)
Plasmid#66880PurposeExpresses a version of pET30Xa-SBL1(160S) with 41 bp Histag removedDepositorInsertsoybean lipoxygenase-1 (S160S)
TagsnoneExpressionBacterialMutationnonePromoterT7lacAvailable SinceAug. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pET30-SBL1(160E,HisTagDel)
Plasmid#66879PurposeExpresses a version of pET30Xa-SBL1(160E) with 41 bp Histag removedDepositorInsertsoybean lipoxygenase-1 (S160E)
ExpressionBacterialMutationS160EPromoterT7lacAvailable SinceAug. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
Gal4pBS13-Pleum
Plasmid#60332PurposeContains a promoter of two gal binding sites coupled with a core promoter derived from native Leucine promoter.DepositorInsertpromoter
UseSynthetic Biology; Yeast synthetic hybrid promote…ExpressionYeastAvailable SinceMay 5, 2015AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCVD403
Plasmid#63740PurposeContains the LT gene probe (HincII fragment) cloned on BamHI linkers into pACYC184DepositorInsertLT gene probe
ExpressionBacterialAvailable SinceApril 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
TRS6E1b-luc(-732/-721) mutant 4
Plasmid#45387DepositorInsert6 copies of hPAI-1 promoter -732/-721 four point mutation (SERPINE1 Human)
UseLuciferaseTagsluciferaseExpressionMammalianMutationmutated from agacaaggttgt to acactaggatgaAvailable SinceJune 20, 2013AvailabilityAcademic Institutions and Nonprofits only -
TRS6E1b-luc(-732/-721) mutant 3
Plasmid#45386DepositorInsert6 copies of hPAI-1 promoter -732/-721 mutated at -723/-721
UseLuciferaseTagsluciferaseExpressionMammalianMutation-723/-721 mutated from tgt to acaAvailable SinceJune 20, 2013AvailabilityAcademic Institutions and Nonprofits only -
TRS6E1b-luc(-732/-721) mutant 2
Plasmid#45385DepositorInsert6 copies of hPAI-1 promoter -732/-721 mutated at -730/-728
UseLuciferaseTagsluciferaseExpressionMammalianMutationmutated at -730/-728 from aca to tgtAvailable SinceJune 20, 2013AvailabilityAcademic Institutions and Nonprofits only -
TRS6E1b-luc(-732/-721) mutant1
Plasmid#45384DepositorInsert6 copies of hPAI1 promoter -732/-721 mutated at -732/-731
UseLuciferaseExpressionMammalianMutationmutated -732/-731 from ag to tcAvailable SinceJune 20, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCMV-Flag-YAP-H122Y
Plasmid#33085DepositorAvailable SinceFeb. 10, 2012AvailabilityAcademic Institutions and Nonprofits only