We narrowed to 16,183 results for: nes
-
Plasmid#249468PurposeTransfer plasmid for stable transgene expression with 2nd or 3rd generation lentiviral systemsDepositorAvailable sinceJune 16, 2026AvailabilityAcademic Institutions and Nonprofits only
-
p_sc-eVIP-delta-puro-EGFP-AKT1-E17K
Plasmid#249441PurposeTransfer plasmid for stable transgene expression with 2nd or 3rd generation lentiviral systemsDepositorAvailable sinceJune 16, 2026AvailabilityAcademic Institutions and Nonprofits only -
p_sc-eVIP-delta-Puro-EGFP-SMAD2-R321Q
Plasmid#249482PurposeTransfer plasmid for stable transgene expression with 2nd or 3rd generation lentiviral systemsDepositorAvailable sinceJune 12, 2026AvailabilityAcademic Institutions and Nonprofits only -
pSA092 CCT3_IVS13-Cas9-BFP
Plasmid#249142PurposeOverexpression of SpCas9-BFP with CCT3 IVS13 intron in 5' UTR and blasticidin resistance gene. Contains Cp36 recombination site.DepositorInsertCCT3_IVS13-Cas9-TagBFP (CCT3 Human, S. pyogenes Cas9, synthetic)
UseCRISPR; Cp36 donor dnaExpressionMammalianMutationCCT3 IVS13 intronPromoterEF1aAvailable sinceJan. 8, 2026AvailabilityAcademic Institutions and Nonprofits only -
pSA074 Cas9-BFP/HBB_IVS2/BFP
Plasmid#249135PurposeOverexpression of SpCas9-BFP with HBB IVS2 intron within BFP coding sequence and blasticidin resistance gene. Contains Cp36 recombination site.DepositorInsertCas9-TagBFP/HBB_IVS2/TagBFP (HBB Human, S. pyogenes Cas9, synthetic)
UseCRISPR; Cp36 donor dnaExpressionMammalianMutationHBB IVS2 intronPromoterEF1aAvailable sinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pSA076 Cas9/HBB_IVS2/Cas9-BFP
Plasmid#249137PurposeOverexpression of SpCas9-BFP with HBB IVS2 intron within Cas9 coding sequence and blasticidin resistance gene. Contains Cp36 recombination site.DepositorInsertCas9/HBB_IVS2/Cas9-TagBFP (HBB Human, S. pyogenes Cas9, synthetic)
UseCRISPR; Cp36 donor dnaExpressionMammalianMutationHBB IVS2 intronPromoterEF1aAvailable sinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
CAG-PM-NGN3-linker-3xFLAG-Dendra2-HA
Plasmid#234888PurposeExpresses human phosphomutant-NGN3 in mammalian cells directly fused to Dendra2 fluorescent protin plus FLAG and HA tagsDepositorInsertPhosphomutant-NGN3-3xFLAG-Dendra2-HA (NEUROG3 Human)
Tags3xFLAG, Dendra2 and HAExpressionMammalianMutationChanged Serines 161, 165, 174, 183 and 191 to Ala…PromoterCAGAvailable sinceSept. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1kh
Plasmid#160297PurposeYeast CRISPR plasmid targeting the kanMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable sinceSept. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1nh
Plasmid#160299PurposeYeast CRISPR plasmid targeting the natMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable sinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1kn
Plasmid#160298PurposeYeast CRISPR plasmid targeting the kanMX and natMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable sinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
P2061
Plasmid#186299PurposeExpresses LexA-HBD-B112 under the control of pAct1 and Cas9 under the control of LexA-HBD-B112+Beta-estradiol inducible promoterDepositorInsertsLexA-HBD-B112
Cas9
UseCRISPR and Synthetic BiologyExpressionBacterial and YeastPromoter2xLexop-minimalCyc1 and PACT1Available sinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pPPC002
Plasmid#171139PurposeFor integration of J1-J23117-sfGFP, Sp.pCas9-dCas9, and BBa_J23107-MCP-SoxS(R93A/S101A) with miniTn7T methodDepositorInsertsJ1-BBa_J23117-sfGFP
Sp.pCas9-dCas9_BBa_J23107-MCP-SoxS(R93A, S101A)
UseCRISPRExpressionBacterialMutationSoxS has R93A and S101A mutationsPromoterJ1-BBa_J23117 and Sp.pCas9, BBa_J23107Available sinceOct. 6, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pJT139_GalL_nCDA1-VRERBE3
Plasmid#145102PurposeExpressing base editor nCDA1-VRERBE3 in yeast cellsDepositorInsertnCDA1-VRERBE3
UseCRISPRExpressionYeastMutationspCas9(D10A/D1135V/G1218R/R1335E/T1337R)PromoterGalLAvailable sinceJuly 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDEST26 Ago2 4A
Plasmid#59907PurposeExpresses 6xHis-Ago2 (N-termi tag) mutated four serines to alanines in mammalian cellsDepositorInsertArgonaute 2 (AGO2 Human)
Tags6xHis (N-termi tag)ExpressionMammalianMutationmutated four serines to alaninesPromoterCMVAvailable sinceMay 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
Khc73(1-387)-GFP
Plasmid#31747DepositorInsertKhc73 (Khc-73 Fly)
TagsGFPExpressionMammalianMutationContains only aa 1-387PromoterMetallothioneinAvailable sinceNov. 8, 2011AvailabilityAcademic Institutions and Nonprofits only -
Khc73(1-432)-GFP
Plasmid#31748DepositorInsertKhc73 (Khc-73 Fly)
TagsGFPExpressionMammalianMutationContains only aa 1-432PromoterMetallothioneinAvailable sinceNov. 8, 2011AvailabilityAcademic Institutions and Nonprofits only -
p_sc-eVIP-delta-Puro-EGFP-PIK3CA-H1047R
Plasmid#249478PurposeTransfer plasmid for stable transgene expression with 2nd or 3rd generation lentiviral systemsDepositorAvailable sinceJune 16, 2026AvailabilityAcademic Institutions and Nonprofits only -
pTB106-Phleo
Plasmid#236780PurposeExpression of Cas9 cytosine base editor (CBE), T7 RNAP, Cas12a and phleomycin selection marker. The CBE contains a ssDNA-DBD from the L. major RAD51 protein. This plasmid is transfected as episome.DepositorInserthyBE4max (CBE); Cas12a (Acidaminococcus sp. BV3L6)-P2A-T7 RNAP
UseCRISPRAvailable sinceApril 6, 2026AvailabilityAcademic Institutions and Nonprofits only -
pSA090 EIF4A3_IVS2-Cas9-BFP
Plasmid#249140PurposeOverexpression of SpCas9-BFP with EIF4A3 IVS2 intron in 5' UTR and blasticidin resistance gene. Contains Cp36 recombination site.DepositorInsertEIF4A3_IVS2-Cas9-TagBFP (EIF4A3 Human, S. pyogenes Cas9, synthetic)
UseCRISPR; Cp36 donor dnaExpressionMammalianMutationEIF4A3 IVS2 intronPromoterEF1aAvailable sinceJan. 8, 2026AvailabilityAcademic Institutions and Nonprofits only -
pTB106-Hyg
Plasmid#236779PurposeExpression of Cas9 cytosine base editor (CBE), T7 RNAP, Cas12a and hygromycin selection marker. The CBE contains a ssDNA-DBD from the L. major RAD51 protein. This plasmid is transfected as episome.DepositorInserthyBE4max (CBE); Cas12a (Acidaminococcus sp. BV3L6)-P2A-T7 RNAP
UseCRISPRAvailable sinceDec. 1, 2025AvailabilityAcademic Institutions and Nonprofits only