We narrowed to 24,835 results for: crispr
-
Plasmid#84256PurposeExpresses optimized Sa sgCXCR4-3 gRNA with an EGFP fluorescent markerDepositorInsertSa sgCXCR4-3
UseCRISPR and LentiviralExpressionMammalianPromotermouse U6Available sinceNov. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pHu6-gRNA-NT1
Plasmid#81203PurposehU6 expression of gRNA NT1DepositorInserthU6 expression of gRNA NT1
ExpressionMammalianPromoterU6Available sinceNov. 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
PM-NM!TA
Plasmid#48651PurposeBacterial NM crRNA expression: targets NM to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicolDepositorInsertBacterial NM crRNA to prototspacer A
UseCRISPRPromoterJ23100 promoterAvailable sinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
AICSDP-63: ACTN2-mEGFP
Plasmid#124607PurposeHomology arms and linker-mEGFP sequence for C-terminus tagging of human ACTN2, via excisable Cas9-excisable CAGGS-mCherry selection cassetteDepositorInsertACTN2 Homology Arms with linker-mEGFP and Cas9-excisable selection cassette (ACTN2 Human)
UseCRISPR; Donor templateExpressionMammalianAvailable sinceMay 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
AICSDP-166:CDH1-mEGFP
Plasmid#193921PurposeHomology arms and LE-mEGFP sequence for C-terminus tagging of human cadherin 1DepositorInsertcadherin 1 Homology Arms with LE-mEGFP (CDH1 Human)
UseAAV and CRISPR; Donor templateTagslinker-mEGFPMutationhomology arms contain point mutations to disrupt …Available sinceDec. 22, 2022AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCBh_3x Flag-NLS-RhCas12f1-NLS_pA_phU6_gRNA scaffold-spacer_pCMV_mCherry_pA
Plasmid#197025PurposeVector encoding a human codon-optimized RhCas12f1 driven by CBh promoter, guide RNAs compatible with RhCas12f1 driven by hU6, and mCherry driven by CMV promoterDepositorInserthumanized RhCas12f1
ExpressionMammalianPromoterCBh, CMV, hU6Available sinceMay 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAG-hAsCas12a-RVR(S542R/K548V/N552R)-NLS(nucleoplasmin)-3xHA (AAS1065)
Plasmid#114092PurposeCAG promoter expression plasmid for human codon optimized AsCas12a-RVR(S542R/K548V/N552R) nuclease with C-terminal NLS and HA tagDepositorInserthuman codon optimized AsCas12a (S542R/K548V/N552R)
TagsNLS(nucleoplasmin) and 3xHAExpressionMammalianMutationS542R, K548V and N552RAvailable sinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET-28b-T7-hAsCas12a(E174R/S542R)-NLS(nucleoplasmin)-6xHis (AAS1880)
Plasmid#114071PurposeT7 promoter bacterial expression plasmid for human codon optimized AsCas12a(E174R/S542R) with C-terminal NLS and His-tagDepositorInserthuman codon optimized AsCas12a (E174R/S542R) with C-terminal NLS and His-tag
TagsNLS(nucleoplasmin) and 6xHisExpressionBacterialMutationE174R and S542RAvailable sinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
-
pITI2
Plasmid#166095PurposeGal inducible expression of D10A-Cas9 nickaseDepositorInsertCas9-D10A
UseCRISPRExpressionYeastMutationspCas9-D10APromoterGal-inducibleAvailable sinceJune 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPH3
Plasmid#166098PurposeGal inducible expression of D10A-Cas9 nickaseDepositorInsertCas9-D10A
UseCRISPRExpressionYeastMutationspCas9-D10APromoterGal-inducibleAvailable sinceApril 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pORFE1001
Plasmid#112079PurposeOverexpression of the AtCAS9 in plant under 2x35S promoterDepositorInsertAtCAS9
UseCRISPRExpressionPlantMutationPlant codon optimized Cas9 S. pyogenesPromoter2x35SAvailable sinceAug. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCASCADE-gapAP1
Plasmid#87146PurposegapAP1 targeting guide RNA E. coli , Low Phosphate InductionDepositorInsertgapAP1 guide array
ExpressionBacterialPromoterE . coli ugpB gene promoter, low phosphate induct…Available sinceMarch 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCASCADE-zwf
Plasmid#65825Purposezwf targeting guide RNA E. coli , Low Phosphate InductionDepositorInsertzwf guide
ExpressionBacterialPromoterE . coli ugpB gene promoter, low phosphate induc…Available sinceSept. 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCASCADE-udhA
Plasmid#65818PurposeudhA targeting guide RNA E. coli , Low Phosphate InductionDepositorInsertudhA guide
ExpressionBacterialPromoterE . coli ugpB gene promoter, low phosphate induc…Available sinceAug. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCASCADE-gltA2
Plasmid#65817PurposegltA targeting guide RNA E. coli , Low Phosphate InductionDepositorInsertgltA2 guide
ExpressionBacterialPromoterE . coli ugpB gene promoter, low phosphate induc…Available sinceJuly 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
Td-CBE-NW
Plasmid#240623PurposeCytidine base editor with narrowed editing windowDepositorInsertTadA-8e (E27R, N46L, N108Q, M151C, Q154Y)-linker-nCas9-P2A-UGI
UseCRISPRExpressionMammalianMutationTadA-8e (E27R, N46L, N108Q, M151C, Q154Y), Cas9-P…Available sinceJuly 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSEED-mGreenLantern:ALFA
Plasmid#219644PurposePermits GoldenGate assembly of donor plasmids (BsmBI) to knock-in mScarlet:ALFA using the SEED/Harvest methodDepositorInsertmGreenLantern:ALFA SEED Cassette
Available sinceOct. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti-SF3B1-K700E-reporter
Plasmid#200318PurposeA fluorescent reporter for SF3B1 K700E mutation. Co-expresses a blasticidin resistance gene for selection. Includes LoxP sites for Cre-mediated deletion of reporter cassette.DepositorInsertBSD-2A-EGFPi
UseLentiviralExpressionMammalianPromoterEF1-aAvailable sinceAug. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTomatoSlicer
Plasmid#221085PurposeDual-color splicing reporter expressing eGFP and tdTomato from the CMV early enhancer/chicken ß-actin (CAGGS) promoter.DepositorTypeEmpty backboneExpressionMammalianAvailable sinceAug. 6, 2024AvailabilityAcademic Institutions and Nonprofits only