We narrowed to 7,879 results for: Lif
-
Plasmid#206812PurposeTemplate for hlpA-mkate2 amplification associated with kanamycin resistance geneDepositorInserthlpA
UseSynthetic BiologyTagsmKate2Available SinceMay 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJethlpAmKate2Spc
Plasmid#206813PurposeTemplate for hlpA-mkate2 amplification associated with spectinomycin resistance geneDepositorInserthlpA
UseSynthetic BiologyTagsmKate2Mutation3insGAvailable SinceMay 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJethlpAmNeonGreenEry
Plasmid#206815PurposeTemplate for hlpA-mneongreen amplification associated with erythromycin resistance geneDepositorInserthlpA
UseSynthetic BiologyTagsmNeonGreenAvailable SinceMay 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
REV7 C-terminal sgRNA
Plasmid#207095PurposepX330 based plasmid for expression of Cas9 and the GCTCATAAAGGCAGCTGAGG sgRNA to target the REV7 locus.DepositorInsertGCTCATAAAGGCAGCTGAGG
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pU6-BoxB-petracrRNA
Plasmid#207625PurposeExpresses BoxB-petracrRNA in mammalian cells (with a human-U6 promoter)DepositorInsertBoxB-petracrRNA
UseSynthetic BiologyPromoterhU6Available SinceFeb. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAM198
Plasmid#227657PurposepRS305 His-HRV3C-Rpn5 WTDepositorAvailable SinceDec. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAM200
Plasmid#227659PurposepRS305 3XFLAG-HRV3C-Rpn5 WTDepositorAvailable SinceDec. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
-
pDR274-gsc2-sgRNA
Plasmid#184818PurposeUsed to synthesize gRNA targeting exon 2 of the gsc2 geneDepositorInsertgsc2-sgRNA
UseCRISPR; Template for sgrna synthesisAvailable SinceMay 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
-
-
pDestTol2-QUAS:NLS-GFP-he1.1:CFP
Plasmid#184815PurposeUsed to generate the Tg(QUAS:NLS-GFP; he1.1:CFP)c682 transgenic lineDepositorInsertQUAS:NLS-GFP-pA; he1.1:CFP
UseZebrafish tol2 transgenesisTagsNLS-GFPAvailable SinceMay 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 N-terminal sgRNA
Plasmid#207094PurposepX330 based plasmid for expression of Cas9 and the TTACTGCAGAATGACTACAG sgRNA to target the SHLD3 locus.DepositorInsertTTACTGCAGAATGACTACAG
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
NBS1 C-terminal sgRNA
Plasmid#207092PurposepX330 based plasmid for expression of Cas9 and the TAAAAAGGAGAAGATAACTG sgRNA to target the NBS1 locus.DepositorInsertTAAAAAGGAGAAGATAACTG
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
RNF169 C-terminal sgRNA
Plasmid#207099PurposepX330 based plasmid for expression of Cas9 and the ACACTTCATTAGGTGCTACT sgRNA to target the RNF169 locus.DepositorInsertACACTTCATTAGGTGCTACT
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD1 N-terminal sgRNA
Plasmid#207101PurposepX330 based plasmid for expression of Cas9 and the ATGGCAGGACTATGGCAGCC sgRNA to target the SHLD1 locus.DepositorInsertATGGCAGGACTATGGCAGCC
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
ATM C-terminal sgRNA
Plasmid#207097PurposepX330 based plasmid for expression of Cas9 and the TTTCTAAAGGCTGAATGAAA sgRNA to target the ATM locus.DepositorInsertTTTCTAAAGGCTGAATGAAA
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 KO sgRNA #1
Plasmid#207105PurposepX330 based plasmid for expression of Cas9 and the CGCTATCAAGATTTATACCT sgRNA to target the SHLD3 locus..DepositorInsertCGCTATCAAGATTTATACCT
ExpressionMammalianPromoterCMV and U6Available SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD2 N-terminal sgRNA
Plasmid#207098PurposepX330 based plasmid for expression of Cas9 and the TTTTTATCAGAAATCATGAG sgRNA to target the SHLD2 locus.DepositorInsertTTTTTATCAGAAATCATGAG
ExpressionMammalianPromoterCMV and U6Available SinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
HaloTag KO sgRNA
Plasmid#207102PurposepX330 based plasmid for expression of Cas9 and the GTCGATGTTGGTCCGCGCGA sgRNA to target the HaloTag coding sequence.DepositorInsertGTCGATGTTGGTCCGCGCGA
ExpressionMammalianPromoterCMV and U6Available SinceMarch 29, 2024AvailabilityAcademic Institutions and Nonprofits only