We narrowed to 9,786 results for: Coli
-
Plasmid#220629PurposeYeast/E. coli shuttle vector in which an RNA polymerase III promoter directs transcription of an RNA containing two tandem MS2 sites.DepositorTypeEmpty backboneExpressionYeastAvailable SinceOct. 9, 2024AvailabilityAcademic Institutions and Nonprofits only
-
pSG15-pBAD-tetO-deGFP
Plasmid#102450PurposeExpresses deGFP fluorescent protein in E. coli. The expression is controlled by a pBAD-tetO combinatorial promoter.DepositorInsertdeGFP
ExpressionBacterialPromoterpBAD-tetOAvailable SinceOct. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBlueKan+cysMPro
Plasmid#187879PurposeEscherichia coli plasmid containing unique cloning sites behind a Campylobacter jejuni cysM promoter. Cloned genes will be expressed from the constitutively expressed C. jejuni promoter.DepositorTypeEmpty backboneExpressionBacterialPromoterCysMAvailable SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSG86-J23151-LasR
Plasmid#102456PurposeExpresses LasR protein in E. coli. The expression is controlled by a constitutive promoter.DepositorAvailable SinceOct. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
MK1283
Plasmid#71428PurposeThis E. coli DH10B strain harbors a shuttle vector plasmid that expresses the Mixed Feedback Loop version of the UBER system with a T7RNAP translation rate of 1535 and a TetR translation rate of 30709DepositorInsertMixed Feedback Loop version of the UBER system
MutationT7 RBS: AACCGAGCCCAATATAGGACCTAGGGTGCCAAAAAA and …Available SinceFeb. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
PtxS1-c003
Plasmid#173076PurposeExpression of recombinant fusion protein in E. coliDepositorInsertPtxS1
ExpressionBacterialMutationD35-I221Available SinceNov. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMAL-c5X-ELP[AV-60]
Plasmid#67012PurposeExpresses malE-ELP[AV-60] in E. coliDepositorInsertmalE-ELP[AV-60]
TagsHis6 and malE-Factor XaExpressionBacterialPromotertacAvailable SinceJan. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMAL-c5X-ELP[V-60]
Plasmid#67013PurposeExpresses malE-ELP[V-60] in E. coliDepositorInsertmalE-ELP[V-60]
TagsHis6 and malE-Factor XaExpressionBacterialPromotertacAvailable SinceJan. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pBSV2G_2
Plasmid#118225PurposeEmpty E. coli - B. burgdorferi shuttle vector, gentamicin resistantDepositorTypeEmpty backboneExpressionBacterialAvailable SinceJan. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pET-6xHis-mCherry(-6)
Plasmid#205045PurposeFluorescent protein with charge-patterned cationic peptide to promote biomolecular condensate formation in E. coliDepositorInsertmCherry(-6)
TagsMGHHHHHGGExpressionBacterialAvailable SinceFeb. 9, 2024AvailabilityAcademic Institutions and Nonprofits only