We narrowed to 15,280 results for: grn
-
Plasmid#232896PurposePlasmid expressing Cas9 and gRNA GAAAACAAAATGCTCAACAG which targets the SRP14 gene.DepositorAvailable sinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pML107-TLG1
Plasmid#232897PurposePlasmid expressing Cas9 and gRNA GATGAAAACGAAGACGTGAG which targets the TLG1 gene.DepositorAvailable sinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-2
Plasmid#232883PurposePlasmid expressing Cas9 and gRNA GGTAGTGTTAGACCTGAACA which targets the LEU2 gene.DepositorAvailable sinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pML107-INO80
Plasmid#232890PurposePlasmid expressing Cas9 and gRNA GGAAGTAGAATCATTCGTAG which targets the INO80 gene.DepositorAvailable sinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSJ107-2x
Plasmid#208812PurposeExpresses SoxS activation domainand gRNA targeting two copies of 107 region within the synthetic promoter in bacterial cellDepositorInsertsgRNA 107-2x_mRFP
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterCRISPR/dCas9-responsive synthetic promoterAvailable sinceDec. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSJ106-2x
Plasmid#208860PurposeExpresses SoxS activation domain and gRNA targeting two copies of 106 region within the synthetic promoter in bacterial cellDepositorInsertsgRNA 106-2x_mRFP
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterCRISPR/dCas9-responsive synthetic promoterAvailable sinceDec. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
Cdk13_intron3_sg3_pX458
Plasmid#127338PurposesgRNA that cuts within intron 3 of mouse CDK13 genomic locus- guide #3DepositorInsertMouse Cdk13 Intron 3 sgRNA
UseCRISPR and Mouse TargetingPromoterU6 PromoterAvailable sinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-intergenic-As
Plasmid#209026PurposeLentiviral vector expressing U6 driven hybrid guide (hgRNA) targeting two intergenic sites in the human genome using SpCas9 and AsCas12a nucleases (CHyMErA system), respectivelyDepositorInsertintergenic hgRNA with SpCas9 tracrRNAv1 & AsCas12a DR
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available sinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-intergenic-Lb
Plasmid#209030PurposeLentiviral vector expressing U6 driven hybrid guide (hgRNA) targeting two intergenic sites in the human genome using SpCas9 and LbCas12a nucleases (CHyMErA system), respectivelyDepositorInsertintergenic hgRNA with SpCas9 tracrRNAv1 & LbCas12a DR
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available sinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV.5’eGFP/sgLMNA
Plasmid#170546PurposeExpresses a sgRNA for 5' tagging to LMNA and contains a cassette with eGFP without homology armsDepositorInsertsgRNA targeting 5'- end of LMNA
UseCRISPR and LentiviralAvailable sinceJan. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgLats1#2/Cre
Plasmid#173600PurposeExpresses a Lats1-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Lats1 (Lats1 Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable sinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgLats1#1/Cre
Plasmid#173599PurposeExpresses a Lats1-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Lats1 (Lats1 Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable sinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgPole#2/Cre
Plasmid#173610PurposeExpresses a Pole-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Pole (Pole Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable sinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgPole#1/Cre
Plasmid#173609PurposeExpresses a Pole-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Pole (Pole Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable sinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pOC2 GFP-Mpp2 KI
Plasmid#183434PurposeCreOFF knock-in for GFP-MPP2 (amino acid position: A4)DepositorInsertgRNA and GFP donor
UseCRISPRExpressionMammalianAvailable sinceApril 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pOC2 Tubb3 no donor
Plasmid#183431PurposeCreOFF gRNA expression for beta3-tubulin (amino acid position: stop codon)DepositorInsertgRNA
UseCRISPRAvailable sinceApril 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
-
PHY55-mouse U6-sgLMNA
Plasmid#164045PurposeU6-driven sgRNA targeting LMNADepositorInsertLMNA targeting sgRNA
UseCRISPRPromotermouse U6Available sinceApril 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO-Cre sgItgb5 v3
Plasmid#158038Purposelenti-viral construct with Cre recombinase and U6 driven sgRNA against mouse Itgb5DepositorInsertItgb5 sgRNA
ExpressionMammalianPromoterU6Available sinceSept. 30, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLKO-Cre sgRipk4 v3
Plasmid#158035Purposelenti-viral construct with Cre recombinase and U6 driven sgRNA against mouse Ripk4DepositorInsertRipk4 sgRNA
ExpressionMammalianPromoterU6Available sinceSept. 29, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits