We narrowed to 8,358 results for: BLI;
-
Plasmid#219884PurposeThe base plasmid of TUNEYALI for TF19DepositorInsertContains gRNA targeting TF19 (YALI1_A20855g) and homologous arm matching TF19
UseTagsExpressionYeastMutationPromoterAvailable sinceJune 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCfb13208
Plasmid#219883PurposeThe base plasmid of TUNEYALI for TF18DepositorInsertContains gRNA targeting TF18 (YALI1_D15792g) and homologous arm matching TF18
UseTagsExpressionYeastMutationPromoterAvailable sinceJune 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCfb13207
Plasmid#219882PurposeThe base plasmid of TUNEYALI for TF17DepositorInsertContains gRNA targeting TF17 (YALI1_B19962g) and homologous arm matching TF17
UseTagsExpressionYeastMutationPromoterAvailable sinceJune 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCfb13244
Plasmid#219915PurposeThe base plasmid of TUNEYALI for TF54DepositorInsertContains gRNA targeting TF54 (YALI1_F26367g) and homologous arm matching TF54
UseTagsExpressionYeastMutationPromoterAvailable sinceJune 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCfb13233
Plasmid#219906PurposeThe base plasmid of TUNEYALI for TF43DepositorInsertContains gRNA targeting TF43 (YALI1_C14774g) and homologous arm matching TF41
UseTagsExpressionYeastMutationPromoterAvailable sinceJune 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCfb13206
Plasmid#219881PurposeThe base plasmid of TUNEYALI for TF16DepositorInsertContains gRNA targeting TF16 (YALI1_B11759g) and homologous arm matching TF16
UseTagsExpressionYeastMutationPromoterAvailable sinceJune 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCfb13196
Plasmid#219871PurposeThe base plasmid of TUNEYALI forTF06DepositorInsertContains gRNA targeting TF06 (YALI1_D34785g) and homologous arm matching TF06
UseTagsExpressionYeastMutationPromoterAvailable sinceJune 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCfb13217
Plasmid#219892PurposeThe base plasmid of TUNEYALI for TF27DepositorInsertContains gRNA targeting TF27 (YALI1_E22758g) and homologous arm matching TF27
UseTagsExpressionYeastMutationPromoterAvailable sinceJune 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCfb13231
Plasmid#219905PurposeThe base plasmid of TUNEYALI for TF41DepositorInsertContains gRNA targeting TF41 (YALI1_D00747g) and homologous arm matching TF40
UseTagsExpressionYeastMutationPromoterAvailable sinceJune 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCfb13213
Plasmid#219888PurposeThe base plasmid of TUNEYALI for TF23DepositorInsertContains gRNA targeting TF23 (YALI1_E32722g) and homologous arm matching TF23
UseTagsExpressionYeastMutationPromoterAvailable sinceJune 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCfb13191
Plasmid#219866PurposeThe base plasmid of TUNEYALI for TF01DepositorInsertContains gRNA targeting TF01 (YALI1_B02091) and homologous arm matching TF01
UseTagsExpressionYeastMutationPromoterAvailable sinceJune 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCfb13195
Plasmid#219870PurposeThe base plasmid of TUNEYALI forTF05DepositorInsertContains gRNA targeting TF05 (YALI1_D02362g) and homologous arm matching TF05
UseTagsExpressionYeastMutationPromoterAvailable sinceJune 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCfb13238
Plasmid#219911PurposeThe base plasmid of TUNEYALI for TF48DepositorInsertContains gRNA targeting TF48 ( YALI1_C18396g) and homologous arm matching TF48
UseTagsExpressionYeastMutationPromoterAvailable sinceJune 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCfb13225
Plasmid#219900PurposeThe base plasmid of TUNEYALI for TF35DepositorInsertContains gRNA targeting TF35 (YALI1_E34586g) and homologous arm matching TF35
UseTagsExpressionYeastMutationPromoterAvailable sinceJune 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCfb13222
Plasmid#219897PurposeThe base plasmid of TUNEYALI for TF32DepositorInsertContains gRNA targeting TF32 (YALI1_F33301g) and homologous arm matching TF32
UseTagsExpressionYeastMutationPromoterAvailable sinceJune 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCfb13227
Plasmid#219902PurposeThe base plasmid of TUNEYALI for TF37DepositorInsertContains gRNA targeting TF37 (YALI1_D01890g) and homologous arm matching TF37
UseTagsExpressionYeastMutationPromoterAvailable sinceJune 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCfb13216
Plasmid#219891PurposeThe base plasmid of TUNEYALI for TF26DepositorInsertContains gRNA targeting TF26 (YALI1_D05594g) and homologous arm matching TF26
UseTagsExpressionYeastMutationPromoterAvailable sinceJune 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCfb13250
Plasmid#219921PurposeThe base plasmid of TUNEYALI for TF60DepositorInsertContains gRNA targeting TF60 (YALI1_B16239g) and homologous arm matching TF60
UseTagsExpressionYeastMutationPromoterAvailable sinceJune 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCfb13229
Plasmid#219904PurposeThe base plasmid of TUNEYALI for TF39DepositorInsertContains gRNA targeting TF39 (YALI1_B16808g) and homologous arm matching TF39
UseTagsExpressionYeastMutationPromoterAvailable sinceJune 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCfb13203
Plasmid#219878PurposeThe base plasmid of TUNEYALI forTF13DepositorInsertContains gRNA targeting TF13 (YALI1_F21261g) and homologous arm matching TF13
UseTagsExpressionYeastMutationPromoterAvailable sinceJune 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCfb13240
Plasmid#219913PurposeThe base plasmid of TUNEYALI for TF50DepositorInsertContains gRNA targeting TF50 (YALI1_F21426g) and homologous arm matching TF50
UseTagsExpressionYeastMutationPromoterAvailable sinceJune 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCfb13192
Plasmid#219867PurposeThe base plasmid of TUNEYALI for TF02DepositorInsertContains gRNA targeting TF02 (YALI1_D21702g) and homologous arm matching TF02
UseTagsExpressionYeastMutationPromoterAvailable sinceJune 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCfb13246
Plasmid#219917PurposeThe base plasmid of TUNEYALI for TF56DepositorInsertContains gRNA targeting TF56 (YALI1_B06110g) and homologous arm matching TF56
UseTagsExpressionYeastMutationPromoterAvailable sinceJune 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCfb13224
Plasmid#219899PurposeThe base plasmid of TUNEYALI for TF34DepositorInsertContains gRNA targeting TF34 (YALI1_E37455g) and homologous arm matching TF34
UseTagsExpressionYeastMutationPromoterAvailable sinceJune 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCfb13214
Plasmid#219889PurposeThe base plasmid of TUNEYALI for TF24DepositorInsertContains gRNA targeting TF24 (YALI1_F28995g) and homologous arm matching TF24
UseTagsExpressionYeastMutationPromoterAvailable sinceJune 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCfb13205
Plasmid#219880PurposeThe base plasmid of TUNEYALI for TF15DepositorInsertContains gRNA targeting TF15 (YALI1_B29562g) and homologous arm matching TF15
UseTagsExpressionYeastMutationPromoterAvailable sinceJune 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCfb13249
Plasmid#219920PurposeThe base plasmid of TUNEYALI for TF59DepositorInsertContains gRNA targeting TF59 ( YALI1_C25877g) and homologous arm matching TF59
UseTagsExpressionYeastMutationPromoterAvailable sinceJune 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCfb13201
Plasmid#219876PurposeThe base plasmid of TUNEYALI forTF11DepositorInsertContains gRNA targeting TF11 (YALI1_E11341g) and homologous arm matching TF11
UseTagsExpressionYeastMutationPromoterAvailable sinceJune 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCfb13211
Plasmid#219886PurposeThe base plasmid of TUNEYALI for TF21DepositorInsertContains gRNA targeting TF21 (YALI1_E20635g) and homologous arm matching TF21
UseTagsExpressionYeastMutationPromoterAvailable sinceJune 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCfb13215
Plasmid#219890PurposeThe base plasmid of TUNEYALI for TF25DepositorInsertContains gRNA targeting TF25 (YALI1_B18134g) and homologous arm matching TF25
UseTagsExpressionYeastMutationPromoterAvailable sinceJune 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCfb13221
Plasmid#219896PurposeThe base plasmid of TUNEYALI for TF31DepositorInsertContains gRNA targeting TF31 (YALI1_D18727g) and homologous arm matching TF31
UseTagsExpressionYeastMutationPromoterAvailable sinceJune 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCfb13235
Plasmid#219908PurposeThe base plasmid of TUNEYALI for TF45DepositorInsertContains gRNA targeting TF45 ( YALI1_B23373g) and homologous arm matching TF45
UseTagsExpressionYeastMutationPromoterAvailable sinceJune 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCfb13212
Plasmid#219887PurposeThe base plasmid of TUNEYALI for TF22DepositorInsertContains gRNA targeting TF22 (YALI1_C25288g) and homologous arm matching TF22
UseTagsExpressionYeastMutationPromoterAvailable sinceJune 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCfb13202
Plasmid#219877PurposeThe base plasmid of TUNEYALI forTF12DepositorInsertContains gRNA targeting TF12 (YALI1_C06870g) and homologous arm matching TF12
UseTagsExpressionYeastMutationPromoterAvailable sinceJune 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCfb13234
Plasmid#219907PurposeThe base plasmid of TUNEYALI for TF44DepositorInsertContains gRNA targeting TF44 (YALI1_B22561g) and homologous arm matching TF44
UseTagsExpressionYeastMutationPromoterAvailable sinceJune 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCfb13219
Plasmid#219894PurposeThe base plasmid of TUNEYALI for TF29DepositorInsertContains gRNA targeting TF29 (YALI1_C09133g) and homologous arm matching TF29
UseTagsExpressionYeastMutationPromoterAvailable sinceJune 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCfb13248
Plasmid#219919PurposeThe base plasmid of TUNEYALI for TF58DepositorInsertContains gRNA targeting TF58 (YALI1_F37742g) and homologous arm matching TF58
UseTagsExpressionYeastMutationPromoterAvailable sinceJune 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
hPLD3-sgRNA-Cas9_mcherry
Plasmid#199342Purposeencodes sgRNA for human PLD3 KO, (target Exon 7) plus Cas9-P2A-mCherryDepositorInserthSpCas9
UseCRISPRTagsP2A-RFPExpressionMammalianMutationPromoterhuman U6Available sinceMay 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
hPLD4-sgRNA-Cas9_mcherry
Plasmid#199343Purposeencodes sgRNA for human PLD4 KO, (target Exon 5) plus Cas9-P2A-mCherryDepositorInserthSpCas9
UseCRISPRTagsP2A-mCherryExpressionMammalianMutationsgRNA: accagtagtatgaagccacgPromoterhuman U6Available sinceMay 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pR6K-crRNA-CASTIF
Plasmid#199654PurposeR6K plasmid with a I-F CAST targeting lacZDepositorInsertCAST I-F systems
UseTagsExpressionBacterialMutationPromoterJ23119 promoterAvailable sinceMay 3, 2024AvailabilityAcademic Institutions and Nonprofits only