We narrowed to 8,684 results for: PAN
-
Plasmid#231326PurposeBEVA Golden Gate cloning vector; BEVA2.0 Broad host range plasmid with stability. L1-RSF1010-Sp-par-ELT4; GG assembly from pGQ0015, pNDGG002, pNDGG005, pOGG012, and pOGG014, SpRDepositorTypeEmpty backboneExpressionBacterialAvailable SinceMay 7, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pNDGG056
Plasmid#231324PurposeBEVA Golden Gate cloning vector; BEVA2.0 Broad host range plasmid with stability. L1-RSF1010-Gm-par-ELT4; GG assembly from pGQ0015, pOGG009, pNDGG005, pOGG012, and pOGG014, GmRDepositorTypeEmpty backboneExpressionBacterialAvailable SinceMay 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pNDGG070
Plasmid#231328PurposeBEVA Golden Gate cloning vector; BEVA2.0 Sucrose curable broad host range plasmid . L1-pBBR1-Sp-sacB-ELT4; GG assembly from pOGG004, pNDGG002, pOGG011, pNDGG008, and pOGG014, SpRDepositorTypeEmpty backboneExpressionBacterialAvailable SinceMarch 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pNDGG049
Plasmid#231318PurposeBEVA Golden Gate cloning vector; BEVA2.0 Broad host range plasmid with stability. -pBBR1-Gm-par-ELT4; GG assembly from pOGG004, pOGG009, pOGG011, pOGG012, and pOGG014, GmRDepositorTypeEmpty backboneExpressionBacterialAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pNDGG021
Plasmid#231305PurposeVector part for BEVA; BEVA2.0 Position 1 Level 1 BsaI cloning site without T0, AmpRDepositorInsertBEVA2.0 Position 1 Level 1 BsaI cloning site without T0, AmpR
ExpressionBacterialAvailable SinceFeb. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pNDGG008
Plasmid#231312PurposeVector part for BEVA; BEVA2.0 Position 4 sacB sucrose counterselection module, AmpR.DepositorInsertBEVA2.0 Position 4 sacB sucrose counterselection module, AmpR.
ExpressionBacterialAvailable SinceFeb. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pQGG002
Plasmid#231329PurposeBEVA Golden Gate cloning vector; BEVA2.0 Narrow host range plasmid with I-SceI counterselectable site. L1-P15A-Nm-ISceI; GG assembly from pOGG004, pNDGG001, pNDGG006, pGQ0023, pOGG014. KmR/NmR.DepositorTypeEmpty backboneExpressionBacterialAvailable SinceFeb. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSEVA47_dCas9-GFP_AAN_4
Plasmid#231415PurposeThis AND-AND-NOT-gate plasmid expresses dCas9 from a constitutive promoter. Its sgRNAs X & Y are repressible by sgRNAs A & B, respectively. Its GFP gene is repressible by any of sgRNAs X, Y, and C.DepositorInsertsdCas9
GFP
sgRNA-X
sgRNA-Y
UseSynthetic BiologyAvailable SinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
AA498
Plasmid#231119PurposeFragmid fragment: (guide cassette) ABE activity-based selection CD274 positive controlDepositorInsertsgCD274 + ABE splice-targeting sgRNA
UseCRISPRExpressionBacterialAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
AA505
Plasmid#231120PurposeFragmid fragment: (guide cassette) CBE activity-based selection CD274 positive controlDepositorInsertsgCD274 + CBE splice-targeting sgRNA
UseCRISPRExpressionBacterialAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
-
pACEBac1_Strep-Psc-BICD2(1-400)
Plasmid#228830PurposeInsect cell expression of N-terminal portion of BICD2 (aa 1-400)DepositorAvailable SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pACEBac1_Strep-Psc-BICD2(1-710)
Plasmid#228831PurposeInsect cell expression of truncated BICD2 (aa 1-710)DepositorAvailable SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLei-sfGFP-V2*D134*Y152*
Plasmid#191112PurposeAn E. coli sfGFP reporter with two TAG at positions 2 & 134 & 152DepositorInsertsuperfolder green fluorescence protein
TagsHis tagExpressionBacterialMutationchanging V2 & D134 & Y152 to TAGAvailable SinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMK468 (BSD-P2A-mAID-dTAG)
Plasmid#214394PurposemAID-dTAG for N-terminal taggingDepositorInsertBSD-P2A-mAID-dTAG
UseCRISPRExpressionMammalianAvailable SinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMK452 (BSD-P2A-dTAG-mClover)
Plasmid#214382PurposedTAG-mClover for N-terminal taggingDepositorInsertBSD-P2A-dTAG-mClover
UseCRISPRExpressionMammalianAvailable SinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS18
Plasmid#215675PurposeCas9 + guide plasmid for inserting ChrI split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GAAATCGCCGACTTGCGAGG
UseCRISPRExpressionWormAvailable SinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS62
Plasmid#215676PurposeCas9 + guide plasmid for inserting ChrIII split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GTCGTTCTTCCGTTCTCGGG
UseCRISPRExpressionWormAvailable SinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
INT_Cargo_T7_gfp
Plasmid#212136PurposeCargo plasmid for integrating PT7 expression cassette of green fluorescent protein in genome.Plasmid can be removed by incubating cells at 37 C.DepositorInsertgreen fluorescent protein
ExpressionBacterialPromoterPT7Available SinceJan. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
INT_Cargo_T7_CbFDH
Plasmid#212140PurposeCargo plasmid for integrating PT7 expression cassette of formate dehydrogenase in genome. Plasmid can be removed by incubating cells at 37 C.DepositorInsertformate dehydrogenase
ExpressionBacterialPromoterPT7Available SinceJan. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
ABE-RA4.1
Plasmid#208306PurposeExpresses ABE-RA4.1 in mammalian cellsDepositorInsertTadA-RA4.1-SpCas9 D10A
ExpressionMammalianMutationP48A, R51H, I76F, A106V, D108G, K110R, T111H, D11…Available SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
ABE-RA4.3
Plasmid#208308PurposeExpresses ABE-RA4.3 in mammalian cellsDepositorInsertTadA-RA4.3-SpCas9 D10A
ExpressionMammalianMutationP48A, R51H, I76F, A106V, D108G, K110R, T111H, D11…Available SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
ABE-RA4.4
Plasmid#208309PurposeExpresses ABE-RA4.4in mammalian cellsDepositorInsertTadA-RA4.4-SpCas9 D10A
ExpressionMammalianMutationP48A, R51H, I76F, A106V, D108G, K110R, T111H, D11…Available SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
ABE-RA4.5
Plasmid#208310PurposeExpresses ABE-RA4.5 in mammalian cellsDepositorInsertTadA-RA4.5-SpCas9 D10A
ExpressionMammalianMutationP48A, R51H, I76F, A106V, D108G, K110R, T111H, D11…Available SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
ABE-RA4.6
Plasmid#208311PurposeExpresses ABE-RA4.6 in mammalian cellsDepositorInsertTadA-RA4.6-SpCas9 D10A
ExpressionMammalianMutationP48A, R51H, I76F, A106V, D108G, K110R, T111H, D11…Available SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
ABE-RA5.0
Plasmid#208312PurposeExpresses ABE-RA5.0 in mammalian cellsDepositorInsertTadA-RA5.0-SpCas9 D10A
ExpressionMammalianMutationW23R, H36L, R47K, P48A, R51L, I76F, V82S, A106V, …Available SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
ABE-RA5.1
Plasmid#208313PurposeExpresses ABE-RA5.1 in mammalian cellsDepositorInsertTadA-RA5.1-SpCas9 D10A
ExpressionMammalianMutationW23R, H36L, R47K, P48A, R51L, I76F, V82S, A106V, …Available SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
ABE-RA5.3
Plasmid#208314PurposeExpresses ABE-RA5.3 in mammalian cellsDepositorInsertTadA-RA5.3-SpCas9 D10A
ExpressionMammalianMutationW23R, H36L, R47K, P48A, R51L, I76F, V82S, A106V, …Available SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
ABE-RA5.4
Plasmid#208315PurposeExpresses ABE-RA5.4 in mammalian cellsDepositorInsertTadA-RA5.4-SpCas9 D10A
ExpressionMammalianMutationW23R, R47K, P48A, R51L, I76Y, V82S, A106V, D108G,…Available SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
ABE-RA5.6
Plasmid#208317PurposeExpresses ABE-RA5.6 in mammalian cellsDepositorInsertTadA-RA5.6-SpCas9 D10A
ExpressionMammalianMutationW23R, H36L, R47K, P48A, R51L, I76Y, V82S, A106V, …Available SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
FB395
Plasmid#203631PurposeTU for the expression of luciferase under a synthetic promoter containing the target sequence for gRNA1 (1xLuc).DepositorInsertR1:G1aG2b.1:mPAF:Luc:TtrpC
UseSynthetic BiologyAvailable SinceSept. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
FB396
Plasmid#203632PurposeTU for the expression of luciferase under a synthetic promoter containing two copies of the target sequence for gRNA1 (2xLuc).DepositorInsertR1:G1ab.1:mPAF:Luc:TtrpC
UseSynthetic BiologyAvailable SinceSept. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
FB397
Plasmid#203633PurposeTU for the expression of luciferase under a synthetic promoter containing three copies of the target sequence for gRNA1 (3xLuc).DepositorInsertR1:G1abc.3:mPAF:Luc:TtrpC
UseSynthetic BiologyAvailable SinceSept. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMetTU1-A_Sv5K_araC-PBAD_MCD1_AnaA-T6A-L40A_AnaCNJKFGW_Bba-B0015
Plasmid#202024PurposeExpresses Anabaena flos-aquae ARG cluster (GvpA T6A-L40A mutant) in E. coliDepositorInsertAnabaena flos-aquae ARG cluster (GvpA T6A-L40A mutant)
ExpressionBacterialMutationGvpA T6A-L40AAvailable SinceAug. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
FB312
Plasmid#203569PurposeTU for the expression of Nanoluciferase (Nluc) under the PgpdA promoter.DepositorInsertPgpdA:Nluc:Ttub
UseSynthetic BiologyAvailable SinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pACT2-μ4
Plasmid#198176PurposeExpression of GAL4 transcriptional activation domain (AD)-AP-4 μ4 fusion protein in yeast (yeast two-hybrid assays)DepositorInsertAP-4 μ4
TagsGAL4 transcriptional activation domain (AD) fragm…ExpressionYeastPromoterADH1Available SinceApril 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pACT2-μ2
Plasmid#198173PurposeExpression of GAL4 transcriptional activation domain (AD)-AP-2 μ2 fusion protein in yeast (yeast two-hybrid assays)DepositorInsertAP-2 μ2
TagsGAL4 transcriptional activation domain (AD) fragm…ExpressionYeastPromoterADH1Available SinceMarch 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pXPR_003 sgPIGA guide 1
Plasmid#193610PurposePIGA knockoutDepositorInsertsgPIGA guide 1 (PIGA Human)
UseLentiviralAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pXPR_003 sgPIGA guide 2
Plasmid#193611PurposePIGA knockoutDepositorInsertsgPIGA guide 2 (PIGA Human)
UseLentiviralAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pXPR_003 sgPIGW guide 1
Plasmid#193612PurposePIGW knockoutDepositorInsertsgPIGW guide 1 (PIGW Human)
UseLentiviralAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pXPR_003 sgPIGW guide 2
Plasmid#193613PurposePIGW knockoutDepositorInsertsgPIGW guide 2 (PIGW Human)
UseLentiviralAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLX317 TFAP4
Plasmid#193616PurposeExpresses TFAP4DepositorInsertTFAP4 (TFAP4 Human)
UseLentiviralAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pXPR_003 sgNFkBIA guide 1
Plasmid#193595PurposeNFkBIA knockoutDepositorInsertsgNFkBIA guide 1 (NFKBIA Human)
UseLentiviralAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pXPR_003 sgNFkBIA guide 2
Plasmid#193596PurposeNFkBIA knockoutDepositorInsertsgNFkBIA guide 2 (NFKBIA Human)
UseLentiviralAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pXPR_003 sgSNRPA guide 1
Plasmid#193598PurposeSNRPA knockoutDepositorInsertsgSNRPA guide 1 (SNRPA Human)
UseLentiviralAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pXPR_003 sgSNRPA guide 2
Plasmid#193599PurposeSNRPA knockoutDepositorInsertsgSNRPA guide 2 (SNRPA Human)
UseLentiviralAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pXPR_003 sgPGD guide 1
Plasmid#193602PurposePGD knockoutDepositorInsertsgPGD guide 1 (PGD Human)
UseLentiviralAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pXPR_003 sgPGD guide 2
Plasmid#193603PurposePGD knockoutDepositorInsertsgPGD guide 2 (PGD Human)
UseLentiviralAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pXPR_003_sgTFAP4 guide 1
Plasmid#193586PurposeTFAP4 knockoutDepositorInsertsgTFAP4 guide 1 (TFAP4 Human)
UseLentiviralAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pXPR_003_sgTFAP4 guide 2
Plasmid#193587PurposeTFAP4 knockoutDepositorInsertsgTFAP4 guide 2 (TFAP4 Human)
UseLentiviralAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only