We narrowed to 13,852 results for: CAN
-
Plasmid#212163PurposeThis binary vector has an empty backbone where you can insert a gene into a cassette with a strong promoter (original 35sCAMV)DepositorTypeEmpty backboneExpressionPlantAvailable SinceMarch 6, 2024AvailabilityAcademic Institutions and Nonprofits only
-
pLSU1/t35S[]:MCS:NosT
Plasmid#212164PurposeThis binary vector has an empty backbone where you can insert a gene into a cassette with a strong promoter (truncated35sCAMV)DepositorTypeEmpty backboneExpressionPlantAvailable SinceMarch 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTfR-mScarlet-I
Plasmid#112954PurposeIn vivo visualization of Transferrin receptors (can be used for colocalization studies)DepositorInsertpTfR
TagsmScarlet-IExpressionMammalianPromoterCMVAvailable SinceAug. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
HsB2AR-mCherry
Plasmid#137785PurposeVisualization of the Beta-2-adrenergic receptorDepositorAvailable SinceFeb. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-FLAG-MTOR-S2215Y
Plasmid#69013Purposeactivating MTOR mutationDepositorAvailable SinceJan. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-FLAG-MTOR-L1460P
Plasmid#69006Purposeactivating MTOR mutationDepositorInsertMTOR-L1460P (MTOR Human)
TagsFLAGExpressionMammalianMutationchange Leucine 1460 to ProlineAvailable SinceDec. 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pEA038
Plasmid#224547PurposeBlast-T2A-2xHA-FKPB12(dTagDegron) mouse Nipbl N-term targeting vectorDepositorInsertFKBP12F36V degron (dTAG system), blasticidin, 2xHA tag
UseMouse TargetingAvailable SinceDec. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
poly H35S SUMO1
Plasmid#221071PurposeExpression of poly H35S SUMO1 protein under T7 promoterDepositorInsertFive repeats of H35S SUMO1 each separated by (GGS)4 (SUMO1 Human)
TagsHis and MBPExpressionBacterialMutationH35SPromotertacAvailable SinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-h53BP1 (siRNA resistant)
Plasmid#110301PurposeMammalian expression of a EGFP-tagged full length human 53BP1 (resistant to siRNA targeting AGAACGAGGAGACGGTAATAGTGGG)DepositorInsertp53-binding protein 1 (TP53BP1 Human)
TagsEGFPExpressionMammalianMutationGAACGAGGA to GAGCGGGGCAvailable SinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
p-EF1a-CreERT2-3Xflag-T2A-eBFP2
Plasmid#170186PurposeThis Cre-ERT2 expressing construct can be used to inducibly recombine loxp sites. It can be used with poly-loxP containing plasmids to generate timestamp barcodes useful for linage tracingDepositorInsertCreERT2-T2A-eBFP2
UseLentiviralPromoterEF1 alphaAvailable SinceJuly 1, 2021AvailabilityAcademic Institutions and Nonprofits only