We narrowed to 14,544 results for: SHR;
-
Plasmid#122231PurposeExpresses shRNA targeting the 3' UTR of human PHBDepositorAvailable SinceAug. 8, 2019AvailabilityAcademic Institutions and Nonprofits only
-
pAAV-GFAP-eGFP-shAqp4-4
Plasmid#223225Purposemir30 based shRNA strategy, shRNA targeting mouse Aqp4DepositorInsertshAqp4 (Aqp4 Mouse)
UseAAVAvailable SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-GFAP-eGFP-shAqp4-3
Plasmid#223224Purposemir30 based shRNA strategy, shRNA targeting mouse Aqp4DepositorInsertshAqp4 (Aqp4 Mouse)
UseAAVAvailable SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-GFAP-eGFP-shAqp4-1
Plasmid#223223Purposemir30 based shRNA strategy, shRNA targeting mouse Aqp4DepositorInsertshAqp4 (Aqp4 Mouse)
UseAAVAvailable SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO-PHB-8
Plasmid#122233PurposeExpresses shRNA targeting the coding sequence of human PHBDepositorInsertshRNA targeting PHB (see partial depositor seq) (PHB1 Human)
UseLentiviral and RNAiExpressionMammalianAvailable SinceAug. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO-PHB-6
Plasmid#122232PurposeExpresses shRNA targeting the coding sequence of human PHBDepositorInsertshRNA targeting PHB (see partial depositor seq) (PHB1 Human)
UseLentiviral and RNAiExpressionMammalianAvailable SinceAug. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO-puro-hPPM1A
Plasmid#185382PurposeFor mammalian expression of shRNA: AGGGTAATGGGTTGCGATATG that targets human PPM1ADepositorAvailable SinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO-puro-hPPM1B
Plasmid#185383PurposeFor mammalian expression of shRNA: GAGCAGAAGAGGATGAATTTA that targets human PPM1BDepositorAvailable SinceJune 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
PRS303-240xtetO
Plasmid#44754DepositorInsert240x tetO array and CHRI homology
ExpressionYeastAvailable SinceOct. 4, 2013AvailabilityAcademic Institutions and Nonprofits only -
pSuperRetropuro-IL-6 scramble
Plasmid#19960DepositorInsertpSuperRetropuro-IL-6 scramble
UseRNAi and RetroviralAvailable SinceJan. 12, 2009AvailabilityAcademic Institutions and Nonprofits only