We narrowed to 13,079 results for: BASE

#113448

ProteinA-mCitrine Gateway shuttle vector for N-terminal fusions

Erich Wanker

Trepte et al Mol Syst Biol. 2018 Jul 11;14(7):e8071.

Aug. 31, 2018

Academic Institutions and Nonprofits only

#75411

tRNA and scaffold for the assembly of GBoligomers for the first position (positon [M1_n-1]) of a polycistronic tRNA-gRNA regulated by the (monocot) U3 promoter (2-part multiplexing)

Diego Orzaez

Vazquez-Vilar et al Plant Methods. 2016 Feb 1;12:10. doi: 10

Aug. 5, 2016

Academic Institutions and Nonprofits only

#113952

mammalian expression plasmid for FLAG-tagged human T1R2 with signal peptide of influenza hemagglutinin; expression-enhanced variant

Erik Procko

Park et al J Biol Chem. 2019 Feb 5. pii: RA118.0061

Feb. 8, 2019

Academic Institutions and Nonprofits only

#113026

Expresses dCas9-GCN4 in mammalian cells

Xingxu Huang

Jiang et al Cell Res. 2018 Jun 6. pii: 10.1038/s4142

July 31, 2018

Academic Institutions and Nonprofits only

#119115

Bacterial expression of human phox homology (PX) domain, SH3PXD2A-PX (1-126)

Brett Collins

Chandra et al Nat Commun. 2019 Apr 4;10(1):1528. doi:

May 25, 2024

Academic Institutions and Nonprofits only

#186969

PiggyBac vector encoding mouse Dnmt3a2 with Ires2-mCherry fluorescent marker for expression in mammalian cells.

Brian Liau

Lue et al Nat Chem Biol. 2023 Feb;19(2):176-186. d

Oct. 14, 2022

Academic Institutions and Nonprofits only

#113953

mammalian expression plasmid for FLAG-tagged human T1R2 with signal peptide of influenza hemagglutinin; expression-enhanced variant

Erik Procko

Park et al J Biol Chem. 2019 Feb 5. pii: RA118.0061

Feb. 8, 2019

Academic Institutions and Nonprofits only

#160622

TU for the constitutive expression of the MS2 coat protein fused on Ct to the activation domain EDLL

Diego Orzaez

Selma et al Plant Biotechnol J. 2019 Sep;17(9):1703-

March 25, 2021

Academic Institutions and Nonprofits only

#87397

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1114a sequence CTTGTGAAACAAATAATTGG in yeast chromosome 11.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#104566

Mammalian expression vector for catalytically inactive Cpf1 from Lachnospiraceae bacterium (dLbCpf1) fused to p65 activation domain

Keith Joung

Tak et al Nat Methods. 2017 Oct 30. doi: 10.1038/n

Jan. 17, 2018

Academic Institutions and Nonprofits only