We narrowed to 13,079 results for: BASE

#87402

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting HIS3b sequence AATATAGAGTGTACTAGAGG in yeast chromosome 15.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#139321

Plasmid expressing a sgRNA to introduce BRCA2 V572I using base editing

Alberto Ciccia

Billon et al Cell Rep. 2020 Mar 10;30(10):3280-3295.e

May 22, 2020

Academic Institutions and Nonprofits only

#75409

tRNA and scaffold for the assembly of GBoligomers for the first position (positon [D1_n-1]) of a polycistronic tRNA-gRNA regulated by the U6-26 or U6-1 promoter (2-part multiplexing)

Diego Orzaez

Vazquez-Vilar et al Plant Methods. 2016 Feb 1;12:10. doi: 10

Aug. 5, 2016

Academic Institutions and Nonprofits only

#119124

Bacterial expression of human phox homology (PX) domain, p47phox-PX (1-122)

Brett Collins

Chandra et al Nat Commun. 2019 Apr 4;10(1):1528. doi:

April 2, 2020

Academic Institutions and Nonprofits only

#207768

Donor template for Blast-2A-sTagRFP insertion into the N-terminus of the TUBA1B locus for tubulin visualization. To be co-transfected with sgRNA plasmid px330-PITCh-TUBA1B Addgene #207763

Laurence Pelletier

Philip et al EMBO J. 2024 Dec 12. doi: 10.1038/s44318

Nov. 15, 2023

Industry, Academic Institutions, and Nonprofits

#205463

A backbone containing a RsDddA fragment A for constructing mitochondria-targeted RsDdCBE expression plasmid

Bin Shen

Cheng et al Mol Ther Nucleic Acids. 2023 Sep 9;34:10

Aug. 25, 2023

Academic Institutions and Nonprofits only

#205465

A backbone containing a RsDddA fragment C for constructing mitochondria-targeted RsDdCBE expression plasmid

Bin Shen

Cheng et al Mol Ther Nucleic Acids. 2023 Sep 9;34:10

Aug. 25, 2023

Academic Institutions and Nonprofits only

#119092

Bacterial expression of human phox homology (PX) domain, SNX11-PX (7-167)

Brett Collins

Chandra et al Nat Commun. 2019 Apr 4;10(1):1528. doi:

July 17, 2020

Academic Institutions and Nonprofits only

#87399

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1309a sequence CCTGTGGTGACTACGTATCC in yeast chromosome 13.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only