We narrowed to 13,079 results for: BASE

#105209

Module 1 - SSX1 promoter drives self-inhibiting mKate2 expression (Version 2 intron - see PMID: 29056342 for detailed information)

Timothy Lu

Nissim et al Cell. 2017 Nov 16;171(5):1138-1150.e15.

Nov. 2, 2018

Academic Institutions and Nonprofits only

#164881

CMV-bpNLS-dCas13d-bpNLS-ADARdd, ADARdd embeded in loop1

Tian Chi

Liu et al EMBO J. 2020 Nov 16;39(22):e104748. doi:

March 2, 2021

Academic Institutions and Nonprofits only

#131492

Endogenous tagging of GSG1-l: C-terminal (amino acid position: STOP codon)

Harold MacGillavry

Willems et al PLoS Biol. 2020 Apr 10;18(4):e3000665. d

Sept. 25, 2019

Academic Institutions and Nonprofits only

#104569

Mammalian expression vector for catalytically inactive Cpf1 from Lachnospiraceae bacterium (dLbCpf1) fused to two DmrA domains

Keith Joung

Tak et al Nat Methods. 2017 Oct 30. doi: 10.1038/n

March 29, 2018

Academic Institutions and Nonprofits only

#84350

Expression of the human Huntingtin Exon1 protein containing 29Q in E.coli

Hilal Lashuel

Vieweg et al J Biol Chem. 2016 Jun 3;291(23):12074-86

Jan. 18, 2018

Academic Institutions and Nonprofits only

#87394

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS911b sequence GTAATATTGTCTTGTTTCCC in yeast chromosome 9.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#49063

Expresses human NKCC1 mutant with HA tag inserted into extracellular loop #2 and an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.

Biff Forbush

Somasekharan et al PLoS One. 2013 Dec 5;8(12):e82060. doi:

Nov. 12, 2013

Academic Institutions and Nonprofits only

#131473

Endogenous tagging of Tarpγ8: Intramolecular (amino acid position: V376)

Harold MacGillavry

Willems et al PLoS Biol. 2020 Apr 10;18(4):e3000665. d

Sept. 25, 2019

Academic Institutions and Nonprofits only

#139331

Plasmid expressing a sgRNA to introduce BRCA1 Q1779Stop using base editing

Alberto Ciccia

Billon et al Cell Rep. 2020 Mar 10;30(10):3280-3295.e

May 22, 2020

Academic Institutions and Nonprofits only

#176256

pNOC episomal plasmid harboring the dead version of humanized fnCas12a gene sequence tagged with Nlux and spacer sequence is replaced by the type IIS restriction site for endonuclease BaeI that can be

John van der Oost

Naduthodi et al ACS Synth Biol. 2021 Dec 17;10(12):3369-

Oct. 28, 2021

Academic Institutions and Nonprofits only